Incidental Mutation 'R0707:Ccr7'
ID63183
Institutional Source Beutler Lab
Gene Symbol Ccr7
Ensembl Gene ENSMUSG00000037944
Gene Namechemokine (C-C motif) receptor 7
SynonymsEBI1, Ebi1h, Cmkbr7, CD197
MMRRC Submission 038890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0707 (G1)
Quality Score112
Status Validated
Chromosome11
Chromosomal Location99144196-99155077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99145983 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 38 (T38S)
Ref Sequence ENSEMBL: ENSMUSP00000099423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103134]
Predicted Effect probably damaging
Transcript: ENSMUST00000103134
AA Change: T38S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099423
Gene: ENSMUSG00000037944
AA Change: T38S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:7tm_1 75 326 1.8e-49 PFAM
Meta Mutation Damage Score 0.1177 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice exhibit an impaired primary immune response. Dendritic cells, B, T and T regulatory cells show impaired migration to the lymph nodes and secondary lymph organs exhibit morphological abnormalities. Lymphocytic infiltrates to the pancreas, lung and stomach are observed in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Ankrd24 A T 10: 81,642,713 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cog6 C T 3: 53,013,862 V108I possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dnajc13 T C 9: 104,172,582 K1780R probably benign Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Herc6 G A 6: 57,662,362 G905E possibly damaging Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr467 A G 7: 107,815,124 D182G probably damaging Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Ccr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Ccr7 APN 11 99145145 missense probably benign 0.45
lanzhou UTSW 11 99145277 missense possibly damaging 0.90
IGL03047:Ccr7 UTSW 11 99145334 missense probably benign 0.44
R1115:Ccr7 UTSW 11 99145277 missense possibly damaging 0.90
R1664:Ccr7 UTSW 11 99145691 missense possibly damaging 0.90
R2291:Ccr7 UTSW 11 99145335 missense probably damaging 1.00
R3743:Ccr7 UTSW 11 99145207 missense possibly damaging 0.86
R4108:Ccr7 UTSW 11 99145378 missense probably damaging 1.00
R4214:Ccr7 UTSW 11 99145046 missense probably damaging 0.98
R5402:Ccr7 UTSW 11 99145734 missense possibly damaging 0.93
R5602:Ccr7 UTSW 11 99145489 missense probably benign 0.08
R6275:Ccr7 UTSW 11 99145663 missense probably damaging 1.00
R6991:Ccr7 UTSW 11 99145304 missense probably damaging 1.00
R7470:Ccr7 UTSW 11 99145557 missense possibly damaging 0.80
R7549:Ccr7 UTSW 11 99145901 missense probably damaging 1.00
Z1176:Ccr7 UTSW 11 99144980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCCCGCTGAAGAAGCTTAAC -3'
(R):5'- ACCCAAAGGGTCTAAGGTCTGAGAG -3'

Sequencing Primer
(F):5'- AAGATCCAGGACTTGGCTTC -3'
(R):5'- gtctaaggtctgagagtctgc -3'
Posted On2013-07-30