Incidental Mutation 'R8129:Pabpc6'
ID631932
Institutional Source Beutler Lab
Gene Symbol Pabpc6
Ensembl Gene ENSMUSG00000046173
Gene Namepoly(A) binding protein, cytoplasmic 6
Synonyms4932702K14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8129 (G1)
Quality Score191.009
Status Validated
Chromosome17
Chromosomal Location9666497-9669704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9668498 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 375 (V375I)
Ref Sequence ENSEMBL: ENSMUSP00000050792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057190]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057190
AA Change: V375I

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050792
Gene: ENSMUSG00000046173
AA Change: V375I

DomainStartEndE-ValueType
RRM 12 85 1.78e-20 SMART
RRM 100 171 2.54e-25 SMART
RRM 192 264 1.08e-28 SMART
RRM 305 376 7.57e-24 SMART
low complexity region 500 511 N/A INTRINSIC
PolyA 561 624 3.28e-34 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 85.2%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,175 D161G probably damaging Het
Adamts19 T C 18: 59,007,487 probably null Het
Ahnak A T 19: 9,000,100 M1L not run Het
Appl1 A G 14: 26,949,509 S329P possibly damaging Het
Bach1 C T 16: 87,722,426 R535W possibly damaging Het
Bicc1 T C 10: 71,079,203 D77G probably benign Het
Bub1b T A 2: 118,638,494 D913E probably benign Het
Cdhr2 G T 13: 54,716,395 probably null Het
Col25a1 T C 3: 130,496,401 S247P probably damaging Het
Commd8 T C 5: 72,162,821 M126V unknown Het
Dpysl4 C T 7: 139,086,160 T13M probably benign Het
Epc1 A G 18: 6,439,634 V776A possibly damaging Het
Fancg G T 4: 43,005,036 probably null Het
Fdx1 T C 9: 51,948,626 T135A probably benign Het
Fgf7 T C 2: 126,035,845 V44A probably benign Het
Fgfr3 A T 5: 33,733,906 M523L probably damaging Het
Focad A T 4: 88,232,763 H548L unknown Het
Ftsj3 C A 11: 106,253,831 V111F probably benign Het
Gm28168 T A 1: 117,929,753 D12E probably damaging Het
Gprin3 T C 6: 59,353,859 T488A probably benign Het
Hormad2 C A 11: 4,346,648 V279L probably benign Het
Hs6st1 A G 1: 36,069,024 K123E probably damaging Het
Ice1 A G 13: 70,606,201 S589P probably benign Het
Il1r1 T A 1: 40,302,287 H286Q probably benign Het
Il1rl1 T A 1: 40,451,827 C423S probably damaging Het
L1td1 A T 4: 98,733,326 M42L probably benign Het
Large1 T C 8: 72,815,957 D713G probably damaging Het
Llgl2 C A 11: 115,850,911 probably null Het
Lrp2 C T 2: 69,430,280 V4536M possibly damaging Het
Map3k19 A C 1: 127,822,683 L977R possibly damaging Het
Myo15 A T 11: 60,508,200 D1617V Het
Nek3 A G 8: 22,149,892 I189T probably damaging Het
Nrap C T 19: 56,366,636 probably null Het
Olfr1249 C A 2: 89,630,448 G150V probably damaging Het
Olfr1375 G A 11: 51,048,383 R92K probably benign Het
Olfr1474 A T 19: 13,471,144 Y16F probably damaging Het
Olfr652 A G 7: 104,564,377 Y52C probably benign Het
Omd A C 13: 49,592,089 D325A probably damaging Het
Pcdha5 A G 18: 36,961,779 D447G probably damaging Het
Pla2r1 A T 2: 60,432,600 W1032R probably damaging Het
Ppp2r5d T C 17: 46,684,337 Y524C probably benign Het
Ppp4r3b T C 11: 29,209,364 Y573H probably damaging Het
Prune2 T C 19: 17,118,836 I568T probably benign Het
Ptpn22 G A 3: 103,890,284 probably null Het
Rbm12b1 A G 4: 12,145,549 D507G probably damaging Het
Rdh7 A G 10: 127,887,501 S162P probably benign Het
Rreb1 C T 13: 37,929,799 A378V probably benign Het
Scaf11 A G 15: 96,419,469 F738S probably damaging Het
Sdk1 C A 5: 142,191,893 N2031K probably benign Het
Serpina3c A T 12: 104,151,797 L94Q probably damaging Het
Sgo2b T C 8: 63,928,800 S333G possibly damaging Het
Slc22a15 A G 3: 101,915,342 V88A possibly damaging Het
Smarcad1 G T 6: 65,067,094 D217Y probably benign Het
Sppl2a A G 2: 126,923,470 F244S probably damaging Het
Sspo G A 6: 48,467,025 D2156N possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tap2 C T 17: 34,205,698 T135I probably benign Het
Tbx15 G T 3: 99,253,938 V20F probably damaging Het
Tes A T 6: 17,065,243 probably benign Het
Tmem39b A T 4: 129,678,675 M378K probably damaging Het
Trim44 A G 2: 102,400,503 V61A unknown Het
Ttll5 T C 12: 85,891,084 probably null Het
Tubgcp4 C T 2: 121,173,628 T50I possibly damaging Het
Txndc17 G A 11: 72,207,762 V47M probably damaging Het
Ubp1 A G 9: 113,975,349 E494G possibly damaging Het
Utp20 A T 10: 88,792,625 S936T probably benign Het
Wdr64 A G 1: 175,775,588 D585G probably damaging Het
Wdtc1 A T 4: 133,304,149 probably null Het
Zfp292 A G 4: 34,807,386 M1891T probably damaging Het
Zfp84 A C 7: 29,776,437 I185L probably benign Het
Zmym4 A G 4: 126,915,163 F364L possibly damaging Het
Other mutations in Pabpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Pabpc6 APN 17 9668498 missense possibly damaging 0.80
IGL00984:Pabpc6 APN 17 9668689 missense probably damaging 1.00
IGL01123:Pabpc6 APN 17 9668147 missense probably benign 0.01
IGL01301:Pabpc6 APN 17 9667970 missense probably benign
IGL02347:Pabpc6 APN 17 9669064 missense probably benign 0.03
ANU18:Pabpc6 UTSW 17 9667970 missense probably benign
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R1593:Pabpc6 UTSW 17 9667813 missense probably damaging 0.98
R1695:Pabpc6 UTSW 17 9668074 missense probably benign 0.01
R3897:Pabpc6 UTSW 17 9669127 missense probably benign 0.38
R3903:Pabpc6 UTSW 17 9669154 missense probably benign 0.16
R4585:Pabpc6 UTSW 17 9669073 missense probably damaging 1.00
R5009:Pabpc6 UTSW 17 9668560 missense probably damaging 1.00
R5112:Pabpc6 UTSW 17 9669611 missense probably damaging 1.00
R5769:Pabpc6 UTSW 17 9667843 nonsense probably null
R6174:Pabpc6 UTSW 17 9668155 missense probably benign
R6488:Pabpc6 UTSW 17 9669599 missense probably damaging 1.00
R7140:Pabpc6 UTSW 17 9668428 missense possibly damaging 0.46
R7586:Pabpc6 UTSW 17 9668682 missense probably damaging 1.00
R8001:Pabpc6 UTSW 17 9669373 missense probably damaging 1.00
R8211:Pabpc6 UTSW 17 9669457 missense probably damaging 1.00
R8393:Pabpc6 UTSW 17 9668506 missense probably damaging 1.00
RF038:Pabpc6 UTSW 17 9668115 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGCTCTGGTACCGTGAG -3'
(R):5'- ATGATGAGCGTCTCCGGAAG -3'

Sequencing Primer
(F):5'- CTGAGTAGTCTGATTAGGAGCAC -3'
(R):5'- AAGGAGTTTTCCCCTTTTGGTAC -3'
Posted On2020-06-30