Incidental Mutation 'R8153:Gen1'
ID633148
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8153 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11260947 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 95 (G95W)
Ref Sequence ENSEMBL: ENSMUSP00000132098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000166117] [ENSMUST00000218259] [ENSMUST00000218487] [ENSMUST00000218547] [ENSMUST00000219600]
Predicted Effect probably benign
Transcript: ENSMUST00000020931
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166117
AA Change: G95W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: G95W

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218259
Predicted Effect probably damaging
Transcript: ENSMUST00000218487
AA Change: G30W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218547
AA Change: G30W

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000219600
AA Change: G95W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,733 S287T probably benign Het
Abca15 T C 7: 120,400,589 S1429P probably damaging Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 probably null Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Cachd1 G T 4: 100,988,638 probably null Het
Cfap61 T C 2: 146,200,784 I1159T probably benign Het
Csf1 T A 3: 107,748,704 D337V probably damaging Het
Ddhd2 T A 8: 25,750,789 T251S probably benign Het
Dnah5 A G 15: 28,384,430 T3107A probably damaging Het
Dnph1 T C 17: 46,499,039 V169A probably benign Het
Ebf2 T C 14: 67,390,465 V303A probably damaging Het
Enpp3 A G 10: 24,809,879 F206S probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fpr-rs3 A G 17: 20,624,423 L152P probably damaging Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm4884 T A 7: 41,043,158 C184S probably benign Het
Gm5580 A T 6: 116,552,007 I282F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsx2 T C 5: 75,077,055 S223P probably damaging Het
Hnf4g C T 3: 3,634,190 probably benign Het
Iqub A C 6: 24,450,790 Y603* probably null Het
Klhl22 A G 16: 17,792,550 N555S probably damaging Het
Lama5 T C 2: 180,187,931 D1928G probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lamc2 CATCAGCTA CA 1: 153,124,104 probably null Het
Lgr4 T A 2: 110,000,300 F255I probably damaging Het
Lnx2 T C 5: 147,028,096 N439S probably benign Het
Lztr1 G T 16: 17,518,575 probably null Het
Nfkb2 G T 19: 46,308,016 R241L probably damaging Het
Nrcam T C 12: 44,584,972 F1103L probably benign Het
Olfr123 A G 17: 37,795,476 I11V probably benign Het
Olfr181 A G 16: 58,925,786 S262P possibly damaging Het
Olfr924 A G 9: 38,848,335 I74V possibly damaging Het
Olfr965 A G 9: 39,719,658 M144V possibly damaging Het
Otof C A 5: 30,388,735 A425S probably damaging Het
Parg T A 14: 32,262,820 L774H probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pcnx4 T A 12: 72,556,243 F426L probably benign Het
Pde5a T G 3: 122,852,576 S805R probably benign Het
Pde5a T A 3: 122,852,578 M806K probably damaging Het
Plekhh1 T C 12: 79,079,038 S1283P probably benign Het
Ppp1r12a A G 10: 108,162,442 K15E probably damaging Het
Prkdc A T 16: 15,664,244 M384L probably damaging Het
Ptchd4 A G 17: 42,503,896 D896G probably benign Het
Rsf1 GGC GGCTACGGCCGC 7: 97,579,906 probably benign Het
Slmap T C 14: 26,533,333 S65G probably benign Het
Snta1 C A 2: 154,380,802 L298F probably damaging Het
Soga3 G T 10: 29,148,239 E384* probably null Het
Sphkap T G 1: 83,278,009 N673T possibly damaging Het
St8sia5 T G 18: 77,253,111 probably null Het
Tgm6 T C 2: 130,145,055 V481A probably benign Het
Thada T C 17: 84,393,427 N1217S possibly damaging Het
Tia1 C G 6: 86,420,332 H107D probably damaging Het
Ttn A G 2: 76,916,612 Y4698H probably benign Het
Ube3c T C 5: 29,606,931 Y390H possibly damaging Het
Ubqln5 A G 7: 104,128,804 I271T possibly damaging Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Xkr9 A G 1: 13,684,139 D119G probably benign Het
Zfp236 C T 18: 82,630,027 C1003Y probably damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
R8061:Gen1 UTSW 12 11261076 splice site probably benign
R8112:Gen1 UTSW 12 11254373 nonsense probably null
R8147:Gen1 UTSW 12 11255050 intron probably null
R8152:Gen1 UTSW 12 11243265 missense probably damaging 0.99
R8161:Gen1 UTSW 12 11241464 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGCAGACACATTTCTCAAGC -3'
(R):5'- TCGCATGAACAGTGTTTAAACCTAG -3'

Sequencing Primer
(F):5'- ACTGCGGAGTATTACTATGTCC -3'
(R):5'- ACCTAGTATTTTGTACTCCTATTGGG -3'
Posted On2020-06-30