Incidental Mutation 'R0014:Gen1'
ID201330
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0014 (G1)
Quality Score58
Status Validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11241641 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 716 (N716D)
Ref Sequence ENSEMBL: ENSMUSP00000151310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably benign
Transcript: ENSMUST00000166117
AA Change: N781D

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: N781D

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218487
AA Change: N716D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
R8112:Gen1 UTSW 12 11254373 nonsense probably null
R8152:Gen1 UTSW 12 11243265 missense probably damaging 0.99
R8153:Gen1 UTSW 12 11260947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTTTCCCAGGAGGCAGTAGAG -3'
(R):5'- GTAGAGACCTTCAGCAGAGCAACC -3'

Sequencing Primer
(F):5'- GTCGAAAACTCTGAGGACTTCTCC -3'
(R):5'- CATGCCCTCAGTATAATGTAGGAGC -3'
Posted On2014-06-02