Incidental Mutation 'R8153:Vmn2r109'
ID 633163
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R8153 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20564707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: V17A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: V17A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,733 S287T probably benign Het
Abca15 T C 7: 120,400,589 S1429P probably damaging Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 92 probably null Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Cachd1 G T 4: 100,988,638 probably null Het
Cfap61 T C 2: 146,200,784 I1159T probably benign Het
Csf1 T A 3: 107,748,704 D337V probably damaging Het
Ddhd2 T A 8: 25,750,789 T251S probably benign Het
Dnah5 A G 15: 28,384,430 T3107A probably damaging Het
Dnph1 T C 17: 46,499,039 V169A probably benign Het
Ebf2 T C 14: 67,390,465 V303A probably damaging Het
Enpp3 A G 10: 24,809,879 F206S probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fpr-rs3 A G 17: 20,624,423 L152P probably damaging Het
Gen1 C A 12: 11,260,947 G95W probably damaging Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm4884 T A 7: 41,043,158 C184S probably benign Het
Gm5580 A T 6: 116,552,007 I282F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gsx2 T C 5: 75,077,055 S223P probably damaging Het
Hnf4g C T 3: 3,634,190 probably benign Het
Iqub A C 6: 24,450,790 Y603* probably null Het
Klhl22 A G 16: 17,792,550 N555S probably damaging Het
Lama5 T C 2: 180,187,931 D1928G probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lamc2 CATCAGCTA CA 1: 153,124,104 probably null Het
Lgr4 T A 2: 110,000,300 F255I probably damaging Het
Lnx2 T C 5: 147,028,096 N439S probably benign Het
Lztr1 G T 16: 17,518,575 probably null Het
Nfkb2 G T 19: 46,308,016 R241L probably damaging Het
Nrcam T C 12: 44,584,972 F1103L probably benign Het
Olfr123 A G 17: 37,795,476 I11V probably benign Het
Olfr181 A G 16: 58,925,786 S262P possibly damaging Het
Olfr924 A G 9: 38,848,335 I74V possibly damaging Het
Olfr965 A G 9: 39,719,658 M144V possibly damaging Het
Otof C A 5: 30,388,735 A425S probably damaging Het
Parg T A 14: 32,262,820 L774H probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pcnx4 T A 12: 72,556,243 F426L probably benign Het
Pde5a T G 3: 122,852,576 S805R probably benign Het
Pde5a T A 3: 122,852,578 M806K probably damaging Het
Plekhh1 T C 12: 79,079,038 S1283P probably benign Het
Ppp1r12a A G 10: 108,162,442 K15E probably damaging Het
Prkdc A T 16: 15,664,244 M384L probably damaging Het
Ptchd4 A G 17: 42,503,896 D896G probably benign Het
Rsf1 GGC GGCTACGGCCGC 7: 97,579,906 probably benign Het
Slmap T C 14: 26,533,333 S65G probably benign Het
Snta1 C A 2: 154,380,802 L298F probably damaging Het
Soga3 G T 10: 29,148,239 E384* probably null Het
Sphkap T G 1: 83,278,009 N673T possibly damaging Het
St8sia5 T G 18: 77,253,111 probably null Het
Tgm6 T C 2: 130,145,055 V481A probably benign Het
Thada T C 17: 84,393,427 N1217S possibly damaging Het
Tia1 C G 6: 86,420,332 H107D probably damaging Het
Ttn A G 2: 76,916,612 Y4698H probably benign Het
Ube3c T C 5: 29,606,931 Y390H possibly damaging Het
Ubqln5 A G 7: 104,128,804 I271T possibly damaging Het
Xkr9 A G 1: 13,684,139 D119G probably benign Het
Zfp236 C T 18: 82,630,027 C1003Y probably damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAGTCAGGCTGAGATTAAGTTAC -3'
(R):5'- TGAATACAGGGCCTCAGCTG -3'

Sequencing Primer
(F):5'- ATTTCATTCCCCCTGAGAGAGG -3'
(R):5'- TACAGGGCCTCAGCTGTAGAG -3'
Posted On 2020-06-30