Incidental Mutation 'R2138:Gen1'
ID235988
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11241621 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 722 (S722R)
Ref Sequence ENSEMBL: ENSMUSP00000151310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably damaging
Transcript: ENSMUST00000166117
AA Change: S787R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: S787R

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218487
AA Change: S722R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCTGAGAACCCGTTTTCTTCATC -3'
(R):5'- GTTCTAGACAGCCGACTCCAAG -3'

Sequencing Primer
(F):5'- AGACTCATTACACAGTTTGGTTTC -3'
(R):5'- CTCCAAGAAAACTGCGGGGC -3'
Posted On2014-10-01