Incidental Mutation 'R7978:Olfr1312'
ID651011
Institutional Source Beutler Lab
Gene Symbol Olfr1312
Ensembl Gene ENSMUSG00000074947
Gene Nameolfactory receptor 1312
SynonymsGA_x6K02T2Q125-73090482-73089529, MOR245-20
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112038068-112050238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112042178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000150415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099600] [ENSMUST00000213582] [ENSMUST00000213961] [ENSMUST00000215531]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099600
AA Change: T285A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097195
Gene: ENSMUSG00000074947
AA Change: T285A

DomainStartEndE-ValueType
Pfam:7tm_4 27 302 1.6e-43 PFAM
Pfam:7tm_1 38 284 1.3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213582
AA Change: T285A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213961
AA Change: T285A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215531
AA Change: T285A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,888,668 I342N probably damaging Het
Alb A T 5: 90,472,073 N453I possibly damaging Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Ap1g1 C T 8: 109,837,767 R315* probably null Het
Cachd1 T C 4: 100,974,863 Y741H probably damaging Het
Cacna2d2 C G 9: 107,518,257 L661V probably benign Het
Ccdc90b T A 7: 92,567,713 H64Q probably damaging Het
Ccdc93 C A 1: 121,499,231 N582K possibly damaging Het
Cdh7 A G 1: 109,994,105 probably benign Het
Cnksr1 T C 4: 134,236,031 N78D probably damaging Het
Cttnbp2nl A G 3: 105,007,991 V132A probably damaging Het
Cwc25 G A 11: 97,753,218 Q230* probably null Het
Dsel G A 1: 111,859,719 R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Fam120a T C 13: 48,902,274 Y646C probably damaging Het
Hltf T C 3: 20,092,804 W576R probably damaging Het
Hmcn2 A G 2: 31,389,347 N1787S probably benign Het
Ift122 A G 6: 115,920,352 E904G probably benign Het
Igkv17-121 C T 6: 68,036,822 T2I unknown Het
Ino80 T G 2: 119,439,393 R590S possibly damaging Het
Intu T A 3: 40,697,639 I842N probably damaging Het
Itgae A T 11: 73,134,087 T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna10 A G 3: 107,194,347 E98G probably damaging Het
Kcnb2 T A 1: 15,710,613 Y570N probably benign Het
Kmt2c T C 5: 25,359,678 I923V probably benign Het
Kptn A G 7: 16,125,772 D307G probably damaging Het
Myo3b T C 2: 70,253,114 Y704H probably damaging Het
Olfr103 A G 17: 37,336,501 F244L probably benign Het
Olfr1186 T A 2: 88,525,670 L29* probably null Het
Olfr48 A T 2: 89,844,267 C235* probably null Het
Pmel G A 10: 128,715,950 V218M probably damaging Het
Prkar2b T C 12: 31,963,025 H364R possibly damaging Het
Psd4 T C 2: 24,404,855 F809S probably damaging Het
Rabgap1l A G 1: 160,251,268 S59P Het
Rgr A G 14: 37,044,688 F134L probably benign Het
Rspry1 G T 8: 94,623,125 R47L probably damaging Het
Scd3 G T 19: 44,234,249 E113* probably null Het
Slc22a12 G A 19: 6,536,908 A476V possibly damaging Het
Smg1 T C 7: 118,193,655 E560G unknown Het
Snx3 A G 10: 42,502,350 D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d12 A G 19: 38,916,841 M667V probably benign Het
Tbc1d30 A T 10: 121,306,199 V81E probably damaging Het
Tbc1d9 A T 8: 83,239,954 I395F probably damaging Het
Tes C A 6: 17,096,323 N103K probably benign Het
Tet2 T C 3: 133,487,665 Y336C possibly damaging Het
Tgfbr3 T C 5: 107,139,860 N491S probably damaging Het
Tomt T C 7: 101,900,347 I245V probably damaging Het
Trbc1 T C 6: 41,538,302 L28P Het
Trp63 T C 16: 25,820,686 V208A unknown Het
Ttll8 G T 15: 88,915,362 N625K probably benign Het
Ush2a T A 1: 188,399,938 W786R probably benign Het
Vmn2r97 A T 17: 18,947,592 I703F probably damaging Het
Other mutations in Olfr1312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr1312 APN 2 112042371 missense probably benign 0.00
IGL01650:Olfr1312 APN 2 112042375 missense possibly damaging 0.84
IGL02390:Olfr1312 APN 2 112042711 missense possibly damaging 0.84
IGL03392:Olfr1312 APN 2 112042976 missense probably benign 0.00
R1170:Olfr1312 UTSW 2 112042215 missense probably benign 0.45
R1620:Olfr1312 UTSW 2 112042246 missense probably benign 0.07
R2083:Olfr1312 UTSW 2 112042553 missense probably benign 0.05
R3605:Olfr1312 UTSW 2 112042823 missense probably benign
R4182:Olfr1312 UTSW 2 112042528 missense probably damaging 1.00
R5739:Olfr1312 UTSW 2 112042783 missense probably damaging 0.99
R6321:Olfr1312 UTSW 2 112042768 missense probably benign 0.07
R7231:Olfr1312 UTSW 2 112042366 missense probably damaging 1.00
R7365:Olfr1312 UTSW 2 112043014 missense possibly damaging 0.95
R7673:Olfr1312 UTSW 2 112042580 missense probably benign
R8112:Olfr1312 UTSW 2 112042637 missense probably damaging 1.00
R8167:Olfr1312 UTSW 2 112042444 missense possibly damaging 0.91
Z1177:Olfr1312 UTSW 2 112042655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACTTTCATAAGATAATGTCCC -3'
(R):5'- GATTCATGTCTGTGGGCTCC -3'

Sequencing Primer
(F):5'- CAAAATAGCATATATGTGTGTGTGTG -3'
(R):5'- TCATTTTTACTGTTCAGAAGCACTC -3'
Posted On2020-09-15