Incidental Mutation 'R8188:Hfe'
ID634993
Institutional Source Beutler Lab
Gene Symbol Hfe
Ensembl Gene ENSMUSG00000006611
Gene Namehemochromatosis
SynonymsMR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8188 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23702034-23710854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23708192 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 63 (V63A)
Ref Sequence ENSEMBL: ENSMUSP00000089298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006787] [ENSMUST00000091706] [ENSMUST00000091707]
Predicted Effect probably benign
Transcript: ENSMUST00000006787
SMART Domains Protein: ENSMUSP00000006787
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
IGc1 44 116 1.03e-14 SMART
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091706
AA Change: V63A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089298
Gene: ENSMUSG00000006611
AA Change: V63A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 30 214 4e-46 PFAM
Pfam:MHC_I_3 53 212 7.4e-12 PFAM
IGc1 232 304 1.03e-14 SMART
transmembrane domain 318 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091707
SMART Domains Protein: ENSMUSP00000089299
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 34 126 7.3e-24 PFAM
IGc1 144 216 1.03e-14 SMART
transmembrane domain 230 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151243
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene affects iron metabolism. Homozygotes for targeted null mutations exhibit increased intestinal iron absorption and an elevated hepatic iron load but reduced duodenal iron stores. Heterozygotes also accumulate more iron than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Camsap2 G T 1: 136,297,394 probably null Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Col20a1 G A 2: 181,016,333 probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Fcamr T A 1: 130,802,928 probably null Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Itk G T 11: 46,331,949 Y564* probably null Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr635 T C 7: 103,979,536 S121P probably damaging Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Hfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Hfe APN 13 23705852 unclassified probably benign
IGL01733:Hfe APN 13 23706865 missense possibly damaging 0.51
IGL02227:Hfe APN 13 23706943 missense probably benign 0.26
IGL02339:Hfe APN 13 23704390 missense probably damaging 0.98
R1669:Hfe UTSW 13 23706127 nonsense probably null
R1704:Hfe UTSW 13 23704408 missense probably damaging 1.00
R4424:Hfe UTSW 13 23706883 missense probably benign 0.06
R4624:Hfe UTSW 13 23706078 nonsense probably null
R4904:Hfe UTSW 13 23708054 missense probably damaging 1.00
R5926:Hfe UTSW 13 23708264 missense probably damaging 0.99
R6246:Hfe UTSW 13 23708229 missense probably damaging 1.00
R6322:Hfe UTSW 13 23705896 missense probably damaging 1.00
R6636:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6636:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R6637:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6637:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R7167:Hfe UTSW 13 23708069 missense probably damaging 1.00
R7374:Hfe UTSW 13 23706047 missense probably damaging 0.99
R7816:Hfe UTSW 13 23704399 missense possibly damaging 0.53
Z1177:Hfe UTSW 13 23706037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACGTACCCTTACTGTGG -3'
(R):5'- AGAACTAACTGTGTCACTCCAC -3'

Sequencing Primer
(F):5'- ACGTACCCTTACTGTGGTTATAG -3'
(R):5'- TCTCTGGCAGCAGGAGGTAAC -3'
Posted On2020-07-13