Incidental Mutation 'R8190:Dnajb8'
ID635073
Institutional Source Beutler Lab
Gene Symbol Dnajb8
Ensembl Gene ENSMUSG00000048206
Gene NameDnaJ heat shock protein family (Hsp40) member B8
SynonymsmDj6, 1700016F14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location88222268-88254415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88222958 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 159 (R159C)
Ref Sequence ENSEMBL: ENSMUSP00000056592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061866
AA Change: R159C

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056592
Gene: ENSMUSG00000048206
AA Change: R159C

DomainStartEndE-ValueType
DnaJ 2 61 5.41e-33 SMART
low complexity region 155 181 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DNAJ/HSP40 family of proteins that regulate chaperone activity. This family member suppresses aggregation and toxicity of polyglutamine proteins, and the C-terminal tail is essential for this activity. It has been implicated as a cancer-testis antigen and as a cancer stem-like cell antigen involved in renal cell carcinoma. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Dnajb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajb8 APN 6 88222854 missense possibly damaging 0.62
IGL01671:Dnajb8 APN 6 88222920 missense probably benign 0.00
IGL01838:Dnajb8 APN 6 88223051 missense possibly damaging 0.85
IGL01976:Dnajb8 APN 6 88222526 missense probably damaging 0.99
IGL03135:Dnajb8 APN 6 88223031 missense probably damaging 1.00
R0511:Dnajb8 UTSW 6 88222485 start codon destroyed probably null 0.98
R0762:Dnajb8 UTSW 6 88223054 missense probably damaging 1.00
R2519:Dnajb8 UTSW 6 88222875 missense probably benign
R5861:Dnajb8 UTSW 6 88223106 missense possibly damaging 0.80
R5946:Dnajb8 UTSW 6 88222593 missense probably benign 0.37
R6575:Dnajb8 UTSW 6 88223075 missense probably damaging 1.00
R6767:Dnajb8 UTSW 6 88222652 missense probably damaging 0.97
R6814:Dnajb8 UTSW 6 88223040 missense probably damaging 1.00
R6872:Dnajb8 UTSW 6 88223040 missense probably damaging 1.00
R8189:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8191:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8192:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8193:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8210:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8219:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8221:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8224:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
R8225:Dnajb8 UTSW 6 88222958 missense possibly damaging 0.87
Z1088:Dnajb8 UTSW 6 88222845 missense probably benign
Z1176:Dnajb8 UTSW 6 88222910 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TATCCCTTCCGAAATCCTGAGG -3'
(R):5'- ACTTGTCCACCCTCATGAGC -3'

Sequencing Primer
(F):5'- CCGAAATCCTGAGGATATTTTCC -3'
(R):5'- TTGCCATTGACAGTTACTGACCG -3'
Posted On2020-07-13