Incidental Mutation 'R8198:Lsg1'
ID635563
Institutional Source Beutler Lab
Gene Symbol Lsg1
Ensembl Gene ENSMUSG00000022538
Gene Namelarge 60S subunit nuclear export GTPase 1
SynonymsD16Bwg1547e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R8198 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location30560494-30587592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30564776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 542 (V542E)
Ref Sequence ENSEMBL: ENSMUSP00000112860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117363] [ENSMUST00000143170]
Predicted Effect probably benign
Transcript: ENSMUST00000117363
AA Change: V542E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112860
Gene: ENSMUSG00000022538
AA Change: V542E

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
SCOP:d1h65a_ 165 280 2e-3 SMART
low complexity region 300 309 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:MMR_HSR1 374 461 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143170
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the yeast large subunit GTPase 1. The encoded protein is necessary for cell viability and may localize in the endoplasmic reticulum, nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 42,003,060 *168R probably null Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
AF366264 T A 8: 13,837,056 Y345F probably benign Het
AI481877 T C 4: 59,065,174 I814V probably benign Het
Ankrd27 T C 7: 35,608,455 V373A probably benign Het
Aoah C T 13: 20,917,120 P270L probably damaging Het
AU041133 C G 10: 82,151,415 P301A probably damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Cd2bp2 A G 7: 127,194,404 S204P possibly damaging Het
Clca4b C A 3: 144,932,406 G32C probably damaging Het
Clcn2 A G 16: 20,707,196 V808A probably damaging Het
Clec4d T C 6: 123,268,006 C82R probably damaging Het
Dennd1c T C 17: 57,066,460 D671G possibly damaging Het
Eml5 G A 12: 98,858,886 R691* probably null Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gm11808 C A 4: 3,973,346 R72L probably benign Het
Gm4922 T C 10: 18,783,592 T461A probably benign Het
Gm9964 A G 11: 79,296,579 V14A unknown Het
Gnb3 T C 6: 124,837,037 Y196C probably benign Het
Hist1h4b C G 13: 23,757,300 Q94E possibly damaging Het
Hps1 C T 19: 42,767,220 R189Q probably benign Het
Iars2 G A 1: 185,297,506 T638I probably benign Het
Itpripl2 A G 7: 118,490,596 S247P probably damaging Het
Leng8 C A 7: 4,144,171 R523S possibly damaging Het
Lhfpl3 T A 5: 23,273,335 V72D probably benign Het
Lmntd2 A T 7: 141,211,221 M426K possibly damaging Het
Mphosph6 C T 8: 117,792,710 V108I probably benign Het
Mta2 A G 19: 8,947,781 T338A probably benign Het
Ncoa7 T C 10: 30,704,668 N98S probably benign Het
Olfr1352 C A 10: 78,984,609 T273K probably benign Het
Olfr652 T A 7: 104,564,933 D237E probably benign Het
Olfr8 T A 10: 78,955,724 V173E probably damaging Het
Pgr T C 9: 8,958,410 V806A possibly damaging Het
Rad54b T C 4: 11,612,440 probably null Het
Sdad1 A T 5: 92,291,952 C405S probably damaging Het
Smg1 T C 7: 118,145,606 I3108V probably benign Het
Spink5 A T 18: 43,992,880 I409F probably benign Het
Syt13 C A 2: 92,953,554 L390M probably damaging Het
Taf5 T A 19: 47,075,773 V385E probably damaging Het
Tdrd9 T A 12: 112,040,429 V909E probably damaging Het
Tex9 G A 9: 72,480,658 probably benign Het
Timm10b G T 7: 105,678,330 E61* probably null Het
Tmprss11g A T 5: 86,498,493 F72I probably benign Het
Trank1 T C 9: 111,390,812 C2206R probably benign Het
Unc45b GC G 11: 82,925,988 probably null Het
Unc93b1 T C 19: 3,941,910 S215P possibly damaging Het
Usp48 C T 4: 137,621,159 probably benign Het
Vmn1r81 A G 7: 12,259,955 V242A possibly damaging Het
Zgrf1 T A 3: 127,596,024 probably null Het
Other mutations in Lsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Lsg1 APN 16 30582095 missense probably damaging 1.00
IGL02023:Lsg1 APN 16 30585676 missense probably damaging 1.00
IGL02530:Lsg1 APN 16 30571242 missense probably benign 0.31
IGL02647:Lsg1 APN 16 30585552 critical splice donor site probably null
IGL02710:Lsg1 APN 16 30571474 missense probably benign
IGL02714:Lsg1 APN 16 30585550 splice site probably null
IGL02938:Lsg1 APN 16 30571206 missense probably benign
R1349:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1372:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1569:Lsg1 UTSW 16 30581005 splice site probably null
R1667:Lsg1 UTSW 16 30571352 missense probably damaging 1.00
R2445:Lsg1 UTSW 16 30564695 missense probably benign 0.01
R2991:Lsg1 UTSW 16 30561729 missense probably damaging 0.97
R3611:Lsg1 UTSW 16 30561795 missense probably benign 0.04
R4256:Lsg1 UTSW 16 30573243 missense probably benign 0.01
R4700:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R4750:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R5114:Lsg1 UTSW 16 30561720 missense probably damaging 1.00
R5580:Lsg1 UTSW 16 30569167 missense probably null 0.91
R5589:Lsg1 UTSW 16 30581001 missense probably damaging 1.00
R5719:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R5721:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R6377:Lsg1 UTSW 16 30574568 missense possibly damaging 0.95
R6899:Lsg1 UTSW 16 30582088 missense probably benign
R7469:Lsg1 UTSW 16 30561817 missense probably benign 0.08
R7530:Lsg1 UTSW 16 30582601 missense possibly damaging 0.65
R7737:Lsg1 UTSW 16 30581185 splice site probably null
R7869:Lsg1 UTSW 16 30564722 missense probably benign 0.00
R8439:Lsg1 UTSW 16 30561751 missense probably damaging 1.00
X0065:Lsg1 UTSW 16 30571458 missense probably benign
Z1177:Lsg1 UTSW 16 30573289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAGGCACAAAGTAAGACTCA -3'
(R):5'- AGTTAGGGCAGTTACTGAAGC -3'

Sequencing Primer
(F):5'- CCTTCCAAGTCCTGGGATTAAAGG -3'
(R):5'- TTAGGGCAGTTACTGAAGCTCCAC -3'
Posted On2020-07-13