Mutagenetix > Incidental Mutation

Incidental Mutation 'R8198:Clcn2'

635562

Institutional Source

Beutler Lab

Gene Symbol

Clcn2

Ensembl Gene

ENSMUSG00000022843

Gene Name

chloride channel, voltage-sensitive 2

Synonyms

ClC-2, nmf240, Clc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.549) question?

Stock #

R8198 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20702964-20717746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20707196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 808 (V808A)

Ref Sequence

ENSEMBL: ENSMUSP00000007207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000056518] [ENSMUST00000118919] [ENSMUST00000120099] [ENSMUST00000131522]

AlphaFold

Q9R0A1

Predicted Effect

probably damaging
Transcript: ENSMUST00000007207
AA Change: V808A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: V808A

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	102	111	N/A	INTRINSIC
Pfam:Voltage_CLC	151	555	1.2e-94	PFAM
Blast:CBS	595	644	3e-12	BLAST
low complexity region	666	680	N/A	INTRINSIC
CBS	803	850	3.69e0	SMART
low complexity region	869	881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056518

SMART Domains

Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

Domain	Start	End	E-Value	Type
low complexity region	45	60	N/A	INTRINSIC
Pfam:FAM131	80	356	6.4e-144	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118919

SMART Domains

Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

Domain	Start	End	E-Value	Type
Pfam:FAM131	1	271	4e-119	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120099
AA Change: V791A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: V791A

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	102	111	N/A	INTRINSIC
Pfam:Voltage_CLC	151	538	5.6e-77	PFAM
Blast:CBS	578	627	4e-12	BLAST
low complexity region	649	663	N/A	INTRINSIC
CBS	786	833	3.69e0	SMART
low complexity region	852	864	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131522

SMART Domains

Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	102	111	N/A	INTRINSIC
Pfam:Voltage_CLC	151	473	4.2e-63	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	T	C	14: 42,003,060	*168R	probably null	Het
Adgrb1	C	A	15: 74,539,245	T330K	probably damaging	Het
AF366264	T	A	8: 13,837,056	Y345F	probably benign	Het
AI481877	T	C	4: 59,065,174	I814V	probably benign	Het
Ankrd27	T	C	7: 35,608,455	V373A	probably benign	Het
Aoah	C	T	13: 20,917,120	P270L	probably damaging	Het
AU041133	C	G	10: 82,151,415	P301A	probably damaging	Het
Aven	C	T	2: 112,559,775	R8W	probably benign	Het
Cd2bp2	A	G	7: 127,194,404	S204P	possibly damaging	Het
Clca4b	C	A	3: 144,932,406	G32C	probably damaging	Het
Clec4d	T	C	6: 123,268,006	C82R	probably damaging	Het
Dennd1c	T	C	17: 57,066,460	D671G	possibly damaging	Het
Eml5	G	A	12: 98,858,886	R691*	probably null	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gm11808	C	A	4: 3,973,346	R72L	probably benign	Het
Gm4922	T	C	10: 18,783,592	T461A	probably benign	Het
Gm9964	A	G	11: 79,296,579	V14A	unknown	Het
Gnb3	T	C	6: 124,837,037	Y196C	probably benign	Het
Hist1h4b	C	G	13: 23,757,300	Q94E	possibly damaging	Het
Hps1	C	T	19: 42,767,220	R189Q	probably benign	Het
Iars2	G	A	1: 185,297,506	T638I	probably benign	Het
Itpripl2	A	G	7: 118,490,596	S247P	probably damaging	Het
Leng8	C	A	7: 4,144,171	R523S	possibly damaging	Het
Lhfpl3	T	A	5: 23,273,335	V72D	probably benign	Het
Lmntd2	A	T	7: 141,211,221	M426K	possibly damaging	Het
Lsg1	A	T	16: 30,564,776	V542E	probably benign	Het
Mphosph6	C	T	8: 117,792,710	V108I	probably benign	Het
Mta2	A	G	19: 8,947,781	T338A	probably benign	Het
Ncoa7	T	C	10: 30,704,668	N98S	probably benign	Het
Olfr1352	C	A	10: 78,984,609	T273K	probably benign	Het
Olfr652	T	A	7: 104,564,933	D237E	probably benign	Het
Olfr8	T	A	10: 78,955,724	V173E	probably damaging	Het
Pgr	T	C	9: 8,958,410	V806A	possibly damaging	Het
Rad54b	T	C	4: 11,612,440		probably null	Het
Sdad1	A	T	5: 92,291,952	C405S	probably damaging	Het
Smg1	T	C	7: 118,145,606	I3108V	probably benign	Het
Spink5	A	T	18: 43,992,880	I409F	probably benign	Het
Syt13	C	A	2: 92,953,554	L390M	probably damaging	Het
Taf5	T	A	19: 47,075,773	V385E	probably damaging	Het
Tdrd9	T	A	12: 112,040,429	V909E	probably damaging	Het
Tex9	G	A	9: 72,480,658		probably benign	Het
Timm10b	G	T	7: 105,678,330	E61*	probably null	Het
Tmprss11g	A	T	5: 86,498,493	F72I	probably benign	Het
Trank1	T	C	9: 111,390,812	C2206R	probably benign	Het
Unc45b	GC	G	11: 82,925,988		probably null	Het
Unc93b1	T	C	19: 3,941,910	S215P	possibly damaging	Het
Usp48	C	T	4: 137,621,159		probably benign	Het
Vmn1r81	A	G	7: 12,259,955	V242A	possibly damaging	Het
Zgrf1	T	A	3: 127,596,024		probably null	Het

Other mutations in Clcn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Clcn2	APN	16	20703641	missense	probably benign	0.08
IGL01657:Clcn2	APN	16	20713619	missense	probably damaging	1.00
IGL01797:Clcn2	APN	16	20712761	missense	probably damaging	1.00
IGL02557:Clcn2	APN	16	20708464	missense	probably damaging	1.00
IGL02624:Clcn2	APN	16	20703348	missense	probably damaging	0.98
IGL02819:Clcn2	APN	16	20709256	nonsense	probably null
IGL03329:Clcn2	APN	16	20712152	missense	probably damaging	1.00
Bemr14	UTSW	16		unclassified
R0008:Clcn2	UTSW	16	20710390	missense	probably null	1.00
R0454:Clcn2	UTSW	16	20710428	critical splice acceptor site	probably null
R1101:Clcn2	UTSW	16	20703595	missense	probably damaging	1.00
R1466:Clcn2	UTSW	16	20712552	splice site	probably benign
R1824:Clcn2	UTSW	16	20715962	missense	probably benign	0.04
R4592:Clcn2	UTSW	16	20709142	missense	probably damaging	0.99
R5011:Clcn2	UTSW	16	20707215	missense	probably damaging	1.00
R5013:Clcn2	UTSW	16	20707215	missense	probably damaging	1.00
R5154:Clcn2	UTSW	16	20703303	missense	probably benign	0.01
R5374:Clcn2	UTSW	16	20709669	missense	possibly damaging	0.78
R5726:Clcn2	UTSW	16	20710535	intron	probably benign
R5787:Clcn2	UTSW	16	20703433	missense	probably damaging	1.00
R5992:Clcn2	UTSW	16	20713654	missense	possibly damaging	0.68
R6045:Clcn2	UTSW	16	20711688	critical splice donor site	probably null
R6663:Clcn2	UTSW	16	20703245	makesense	probably null
R6765:Clcn2	UTSW	16	20707668	splice site	probably null
R6825:Clcn2	UTSW	16	20709658	utr 3 prime	probably benign
R7872:Clcn2	UTSW	16	20708460	missense	probably damaging	0.99
R8028:Clcn2	UTSW	16	20708762	missense	possibly damaging	0.66
R8805:Clcn2	UTSW	16	20713418	missense	probably damaging	1.00
R8924:Clcn2	UTSW	16	20712180	missense	probably damaging	1.00
R8992:Clcn2	UTSW	16	20712330	missense	probably damaging	1.00
R9074:Clcn2	UTSW	16	20712664	missense	possibly damaging	0.78
R9101:Clcn2	UTSW	16	20707229	missense	probably benign	0.00
R9456:Clcn2	UTSW	16	20715952	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTCCATGGGGTAACTGTGAG -3'
(R):5'- CATCTTGGGAGGAAAGCTGG -3'

Sequencing Primer
(F):5'- GAAAATTGATGCCTGGCTCC -3'
(R):5'- GCAAACCAGCCTTCCGG -3'

Posted On

2020-07-13