Incidental Mutation 'R8220:Lamb3'
ID636594
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R8220 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 193334248 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 679 (L679Q)
Ref Sequence ENSEMBL: ENSMUSP00000016315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000194677]
Predicted Effect probably damaging
Transcript: ENSMUST00000016315
AA Change: L679Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: L679Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159955
AA Change: L679Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: L679Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194677
AA Change: L679Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: L679Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,835 C106S probably damaging Het
4930427A07Rik T C 12: 113,156,755 probably null Het
7420426K07Rik A G 9: 98,903,528 D82G probably benign Het
Abca13 C T 11: 9,434,299 T3917M possibly damaging Het
Abcb8 T C 5: 24,406,785 I533T possibly damaging Het
Becn1 C T 11: 101,296,279 R78Q possibly damaging Het
Bhlha9 T C 11: 76,672,877 I110T probably damaging Het
Cemip T C 7: 83,947,160 D1132G probably damaging Het
Cyth3 T A 5: 143,701,589 probably null Het
Dcpp2 A G 17: 23,900,692 E160G possibly damaging Het
Dock10 C T 1: 80,528,649 G1726S probably null Het
Dsel T C 1: 111,861,707 D366G probably damaging Het
Ednrb A T 14: 103,821,705 L295Q probably damaging Het
Etaa1 C T 11: 17,945,690 R809K probably benign Het
Fahd1 A G 17: 24,849,890 L71P probably damaging Het
Fat1 A G 8: 45,039,956 E3882G probably null Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gba2 T G 4: 43,568,510 D652A probably damaging Het
Gm15448 T C 7: 3,822,904 E322G unknown Het
Gm5460 C T 14: 34,045,919 P220S probably damaging Het
Gm7137 A T 10: 77,787,951 C84S unknown Het
Gm8122 G T 14: 43,232,717 probably null Het
Hist1h1e T C 13: 23,621,939 S187G probably benign Het
Hyal5 A T 6: 24,876,880 I251L probably benign Het
Igf2r A T 17: 12,692,071 S1953R probably benign Het
Igkc C A 6: 70,726,682 N82K Het
Il18 T A 9: 50,575,316 M15K possibly damaging Het
Insr T A 8: 3,158,702 E1253V probably benign Het
Itgax A G 7: 128,130,918 Q82R probably benign Het
Kcnn3 A G 3: 89,661,241 I609V probably benign Het
Klk14 A G 7: 43,694,074 D110G probably damaging Het
Lgsn C T 1: 31,196,800 A115V probably benign Het
Lipt1 C T 1: 37,875,625 T254M probably damaging Het
Lrrc3b T C 14: 15,358,004 T201A probably damaging Het
Lrrc49 T A 9: 60,610,330 D432V probably benign Het
Mfi2 A G 16: 31,887,415 N239S probably benign Het
Mki67 G A 7: 135,698,121 A1728V probably benign Het
Mms22l T A 4: 24,536,375 L615I probably damaging Het
Mttp C A 3: 138,123,848 G93V probably benign Het
Muc4 A T 16: 32,755,327 T1734S unknown Het
Myh9 C T 15: 77,764,547 R1703Q possibly damaging Het
N4bp1 T C 8: 86,844,687 *894W probably null Het
Nab2 C A 10: 127,662,776 V475L probably benign Het
Nup43 C T 10: 7,676,333 A295V probably benign Het
Olfr1047 C T 2: 86,228,965 G2E probably benign Het
Olfr1158 C T 2: 87,990,152 L14F probably damaging Het
Olfr1271 T C 2: 90,266,043 H129R probably benign Het
Olfr366 T C 2: 37,219,779 C97R probably benign Het
Olfr851 G T 9: 19,497,021 S91I probably damaging Het
Pcdha11 A G 18: 37,006,571 T418A probably benign Het
Pdzd2 T C 15: 12,592,163 K132E probably damaging Het
Plec C T 15: 76,178,297 R2480H possibly damaging Het
Plscr2 G A 9: 92,295,660 G293D probably damaging Het
Ptchd4 A G 17: 42,502,663 H485R probably benign Het
Rbbp9 A T 2: 144,548,066 M59K probably null Het
Rest G A 5: 77,282,478 A915T probably benign Het
Rhbdf1 C T 11: 32,214,563 A168T probably benign Het
Scamp2 A T 9: 57,577,670 Q53L probably benign Het
Scn2a1 T C 2: 65,690,276 F539L probably benign Het
Sdr16c6 A T 4: 4,076,872 I9N probably benign Het
Slc23a3 T A 1: 75,133,867 probably benign Het
Slc6a19 A G 13: 73,685,770 S390P probably damaging Het
Snx11 C T 11: 96,771,059 R99Q probably damaging Het
Soga3 C T 10: 29,147,268 Q204* probably null Het
Suclg2 T A 6: 95,588,946 I189F possibly damaging Het
Timeless A T 10: 128,246,396 R598W probably damaging Het
Tm9sf3 A T 19: 41,215,087 N583K possibly damaging Het
Tox3 A G 8: 90,258,080 V157A probably damaging Het
Tpr G T 1: 150,432,413 V1640L probably benign Het
Trav7-4 C T 14: 53,461,645 A83V probably benign Het
Trdn A G 10: 33,450,985 K590R possibly damaging Het
Trim11 T C 11: 58,990,394 L371P probably damaging Het
Trim5 T A 7: 104,276,826 Q176L probably damaging Het
Tubgcp2 T C 7: 140,006,140 H412R possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Ush2a T A 1: 188,728,666 V2708E probably damaging Het
Vmn1r87 T A 7: 13,131,500 T287S possibly damaging Het
Zbtb7a A G 10: 81,145,004 D344G probably damaging Het
Zfp560 G T 9: 20,349,052 N171K probably benign Het
Zfp579 A T 7: 4,993,851 C354S probably benign Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0265:Lamb3 UTSW 1 193320531 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 splice site probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2147:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2879:Lamb3 UTSW 1 193330784 missense possibly damaging 0.67
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4790:Lamb3 UTSW 1 193339886 missense probably damaging 1.00
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5952:Lamb3 UTSW 1 193332362 missense probably benign 0.04
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8051:Lamb3 UTSW 1 193330067 missense possibly damaging 0.80
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTCAGCACCATGTGGATC -3'
(R):5'- AGAACTGTCAGACACTTGCTG -3'

Sequencing Primer
(F):5'- AGCACCATGTGGATCGTTCC -3'
(R):5'- GCTCATAAGCCATGGTCAGCATG -3'
Posted On2020-07-13