Incidental Mutation 'R4790:Lamb3'
ID472696
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission 042418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4790 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 193339886 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1014 (V1014D)
Ref Sequence ENSEMBL: ENSMUSP00000142053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000194677]
Predicted Effect probably damaging
Transcript: ENSMUST00000016315
AA Change: V1014D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: V1014D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159955
AA Change: V1014D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: V1014D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194677
AA Change: V1014D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: V1014D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
Abca5 T G 11: 110,311,410 T390P possibly damaging Het
Acss3 A T 10: 107,023,702 Y345* probably null Het
Adam26b A T 8: 43,520,727 S413T probably benign Het
Angpt2 T A 8: 18,714,082 Q148L probably damaging Het
Ank3 T A 10: 69,988,151 Y883* probably null Het
Ankrd52 A G 10: 128,380,945 K190E possibly damaging Het
Anks1b A G 10: 90,163,275 R415G probably damaging Het
Ano3 T A 2: 110,884,919 Q58L probably benign Het
Arhgap39 A T 15: 76,726,731 M924K possibly damaging Het
AU040320 A G 4: 126,847,215 M910V possibly damaging Het
BC051019 T A 7: 109,716,346 H86L probably benign Het
C1qbp G A 11: 70,980,030 Q151* probably null Het
C4b G T 17: 34,734,143 D1069E probably benign Het
C77080 C A 4: 129,223,302 R523L probably damaging Het
Casp1 C T 9: 5,303,020 T158I probably benign Het
Casq1 T C 1: 172,216,837 D141G probably damaging Het
Ccdc33 T A 9: 58,029,957 E653V probably damaging Het
Cd180 C T 13: 102,702,822 T71M probably damaging Het
Cdk4 T C 10: 127,064,701 L112P probably damaging Het
Celf2 A G 2: 6,549,903 F425S probably damaging Het
Chrm3 A T 13: 9,877,662 V446E probably benign Het
Chst9 A T 18: 15,453,050 L152H probably damaging Het
Cib2 A G 9: 54,549,803 probably null Het
Clec18a T C 8: 111,072,085 S366G probably damaging Het
Crebbp A G 16: 4,180,119 F34L probably damaging Het
Dapk1 AT A 13: 60,723,105 probably null Het
Ddi1 T A 9: 6,265,761 M203L probably benign Het
Ddx20 G T 3: 105,683,169 S270R probably benign Het
Epp13 A T 7: 6,266,318 K31* probably null Het
Espnl A T 1: 91,344,424 E458V probably damaging Het
Fat3 T C 9: 15,998,484 D2074G probably damaging Het
Fcf1 A G 12: 84,974,128 T61A probably benign Het
Fkbp15 T C 4: 62,307,997 R772G probably benign Het
Flnb T C 14: 7,905,661 V1137A probably benign Het
Fosb C A 7: 19,309,388 C15F probably damaging Het
Frem2 A T 3: 53,516,741 W3092R probably benign Het
Gm3248 T C 14: 5,945,831 I28V probably damaging Het
Gm4922 G T 10: 18,784,168 L269I possibly damaging Het
Gucy2e G A 11: 69,228,448 R627W probably damaging Het
Hephl1 T A 9: 15,059,171 E1009V probably damaging Het
Hsf4 A T 8: 105,270,605 Q61L probably damaging Het
Itgam T A 7: 128,116,273 N1046K probably benign Het
Itgav G A 2: 83,755,810 C138Y probably damaging Het
Itih4 A T 14: 30,889,910 Y157F probably damaging Het
Kcnt2 C T 1: 140,354,516 R80C probably damaging Het
Kdm4b G A 17: 56,401,618 V986M probably damaging Het
Lrrc74b G T 16: 17,549,853 N282K probably damaging Het
Map3k20 T A 2: 72,441,704 H725Q probably benign Het
Mink1 A G 11: 70,599,041 N81S probably damaging Het
Mmp21 A G 7: 133,675,030 Y415H probably damaging Het
Mycbp2 A T 14: 103,229,437 W1297R probably damaging Het
Myh8 T C 11: 67,279,963 M95T probably damaging Het
Myo7b A T 18: 32,000,105 probably null Het
Nanog A G 6: 122,707,915 M20V probably benign Het
Ncapd3 A G 9: 27,051,850 I484V probably benign Het
Ndufa12 A T 10: 94,220,758 N116I probably benign Het
Nedd4l A G 18: 65,203,945 I668V possibly damaging Het
Nobox T C 6: 43,305,546 D309G probably benign Het
Npnt A G 3: 132,890,762 probably benign Het
Nrxn1 A C 17: 90,455,049 Y2D possibly damaging Het
Obox6 G T 7: 15,834,577 P125T possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1079 T C 2: 86,538,880 T10A possibly damaging Het
Olfr1193 T A 2: 88,678,387 N177K possibly damaging Het
Olfr1436 A G 19: 12,298,941 Y64H possibly damaging Het
Olfr202 A T 16: 59,284,458 V13D probably damaging Het
Olfr679 T C 7: 105,086,637 probably benign Het
Olfr697 C G 7: 106,741,791 V48L probably benign Het
Olfr761 T C 17: 37,952,742 Y94C probably damaging Het
Osm A T 11: 4,238,435 M21L probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otud4 T G 8: 79,666,773 S493A possibly damaging Het
Pars2 A G 4: 106,651,111 probably benign Het
Phlda3 T A 1: 135,766,819 V124E possibly damaging Het
Pias4 T C 10: 81,157,492 D199G probably damaging Het
Pm20d1 T C 1: 131,812,039 L375P probably benign Het
Pole2 T C 12: 69,226,365 I48V probably benign Het
Prrc2c T C 1: 162,710,481 R527G unknown Het
Rasgrf2 G T 13: 91,988,016 N592K probably damaging Het
Rbm7 A G 9: 48,495,174 L26P probably damaging Het
Rhag A G 17: 40,831,290 H208R probably benign Het
Rnf17 A G 14: 56,434,355 E268G probably damaging Het
Rnf220 A G 4: 117,289,055 V23A probably benign Het
Rnf7 A T 9: 96,478,419 V55D probably damaging Het
Sdr9c7 C A 10: 127,903,579 R188S possibly damaging Het
Senp6 T A 9: 80,089,858 N51K probably benign Het
Skint3 C A 4: 112,255,898 T235K possibly damaging Het
Slc10a5 A G 3: 10,335,036 F188S probably damaging Het
Slc41a1 G A 1: 131,830,952 G111R probably damaging Het
Smarca1 T C X: 47,884,067 D132G probably null Het
Snrnp48 C T 13: 38,221,323 R299W probably damaging Het
Sspo G A 6: 48,460,771 G1413D probably benign Het
Star T A 8: 25,808,616 H16Q probably damaging Het
Strc T C 2: 121,375,594 D779G probably benign Het
Sulf2 T C 2: 166,089,295 Y264C probably damaging Het
Supt7l A G 5: 31,522,904 S6P possibly damaging Het
Syne2 A G 12: 76,020,391 D4289G probably benign Het
Szrd1 A T 4: 141,139,690 probably null Het
Tada1 T C 1: 166,391,954 V275A possibly damaging Het
Tbr1 A T 2: 61,811,588 Y136F probably benign Het
Tbx20 T A 9: 24,725,714 H359L probably benign Het
Thbs4 G T 13: 92,762,806 D560E probably damaging Het
Tnfsf14 T C 17: 57,190,740 H164R probably damaging Het
Trmu T C 15: 85,882,805 S72P probably damaging Het
Tsnaxip1 C A 8: 105,833,523 Q36K probably benign Het
Ttc28 T A 5: 111,224,217 M844K possibly damaging Het
Tubgcp2 T C 7: 139,999,288 Y695C probably damaging Het
Ugt1a10 T A 1: 88,056,287 M269K probably damaging Het
Urb1 A T 16: 90,769,555 L1448* probably null Het
Vmn2r124 A T 17: 18,049,593 H37L probably damaging Het
Vmn2r44 T C 7: 8,367,950 N699S probably damaging Het
Vps35 A T 8: 85,278,857 probably null Het
Yipf1 G T 4: 107,336,199 probably null Het
Zfp395 A G 14: 65,386,541 N153S possibly damaging Het
Zfp395 A G 14: 65,393,207 D402G probably damaging Het
Zfp652 T C 11: 95,749,609 V120A probably damaging Het
Zp3r T C 1: 130,582,892 I364M probably damaging Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0265:Lamb3 UTSW 1 193320531 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 unclassified probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2147:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2879:Lamb3 UTSW 1 193330784 missense possibly damaging 0.67
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5952:Lamb3 UTSW 1 193332362 missense probably benign 0.04
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8051:Lamb3 UTSW 1 193330067 missense possibly damaging 0.80
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATAGACTCTGAGCTGCAG -3'
(R):5'- GCTGGGATGACTCTACCATC -3'

Sequencing Primer
(F):5'- ATAGACTCTGAGCTGCAGTATGG -3'
(R):5'- TTATACCTCCTGGGCATTCATTG -3'
Posted On2017-04-14