Incidental Mutation 'R5952:Lamb3'
ID470932
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193332362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 610 (T610A)
Ref Sequence ENSEMBL: ENSMUSP00000142053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000194677]
Predicted Effect probably benign
Transcript: ENSMUST00000016315
AA Change: T610A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: T610A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159955
AA Change: T610A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: T610A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194677
AA Change: T610A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: T610A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0265:Lamb3 UTSW 1 193320531 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 unclassified probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2147:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2879:Lamb3 UTSW 1 193330784 missense possibly damaging 0.67
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4790:Lamb3 UTSW 1 193339886 missense probably damaging 1.00
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8051:Lamb3 UTSW 1 193330067 missense possibly damaging 0.80
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGAGGAACAGAGGGTCCTG -3'
(R):5'- TGTGGTCCTCACCCAAATCC -3'

Sequencing Primer
(F):5'- TGGCTGTGACAAAGCCTCAG -3'
(R):5'- GGTCCTCACCCAAATCCACTGG -3'
Posted On2017-03-31