Incidental Mutation 'R2147:Lamb3'
ID233885
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R2147 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 193327904 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 275 (V275A)
Ref Sequence ENSEMBL: ENSMUSP00000142053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably benign
Transcript: ENSMUST00000016315
AA Change: V275A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: V275A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159955
AA Change: V275A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: V275A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161526
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194677
AA Change: V275A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: V275A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cep57l1 A G 10: 41,740,899 Y131H probably damaging Het
Cfap44 A G 16: 44,451,684 R1267G probably benign Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pank1 T C 19: 34,827,354 H134R probably benign Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Skint8 C G 4: 111,937,077 N221K probably damaging Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vmn2r-ps159 T C 4: 156,334,719 noncoding transcript Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0265:Lamb3 UTSW 1 193320531 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 unclassified probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2879:Lamb3 UTSW 1 193330784 missense possibly damaging 0.67
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4790:Lamb3 UTSW 1 193339886 missense probably damaging 1.00
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5952:Lamb3 UTSW 1 193332362 missense probably benign 0.04
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8051:Lamb3 UTSW 1 193330067 missense possibly damaging 0.80
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCATCACAGTGTTACAGGAAC -3'
(R):5'- AGCAGATTCCCAGTGTTCCAG -3'

Sequencing Primer
(F):5'- CTGGGTGAAGGCTGAAGCATTTAG -3'
(R):5'- GATTCCCAGTGTTCCAGGTAAACAG -3'
Posted On2014-10-01