Incidental Mutation 'R8277:Hao2'
ID638017
Institutional Source Beutler Lab
Gene Symbol Hao2
Ensembl Gene ENSMUSG00000027870
Gene Namehydroxyacid oxidase 2
SynonymsHao3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8277 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98874521-98893239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98880384 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 243 (I243T)
Ref Sequence ENSEMBL: ENSMUSP00000029464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029464]
Predicted Effect probably damaging
Transcript: ENSMUST00000029464
AA Change: I243T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029464
Gene: ENSMUSG00000027870
AA Change: I243T

DomainStartEndE-ValueType
Pfam:FMN_dh 13 350 1.8e-127 PFAM
Pfam:Glu_synthase 258 314 1.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Electrophoretic variants are known for this locus in kidney. The a allele determines a slow anodally migrating band in all inbred strains tested; the b allele determines a fast band in M. m. castaneus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C A 19: 57,215,919 L13F probably benign Het
Apoe C T 7: 19,698,378 probably benign Het
Arap2 A G 5: 62,613,992 probably null Het
Aspm T C 1: 139,455,010 S27P probably damaging Het
Atcay C A 10: 81,214,812 D90Y probably damaging Het
Cd46 A T 1: 195,064,722 D327E probably damaging Het
Cfh A G 1: 140,101,609 W1001R probably damaging Het
Chrm2 G A 6: 36,523,276 V23M probably benign Het
Col1a2 G A 6: 4,516,410 G175R probably null Het
Ddx52 T C 11: 83,955,114 S422P probably damaging Het
Gucy2d T A 7: 98,443,475 W20R probably benign Het
Hmcn2 A C 2: 31,369,177 T1010P probably benign Het
Iqcf1 T C 9: 106,501,878 S29P probably benign Het
Kat2b T A 17: 53,641,253 D350E probably benign Het
Lingo4 A G 3: 94,402,624 S290G possibly damaging Het
Mmrn1 A G 6: 60,977,236 T834A probably benign Het
Mro A T 18: 73,864,061 probably benign Het
Mrps26 T A 2: 130,564,427 L160Q probably damaging Het
Myh8 T C 11: 67,292,909 I788T probably benign Het
Nab2 G A 10: 127,665,299 probably benign Het
Nr2c2ap C T 8: 70,132,481 Q67* probably null Het
Olfr404-ps1 C T 11: 74,240,016 L151F probably benign Het
Pask C T 1: 93,325,363 probably null Het
Pcnx2 A T 8: 125,866,016 S736R probably damaging Het
Per2 G T 1: 91,420,552 D1109E probably benign Het
Plxna1 G A 6: 89,357,180 H156Y probably damaging Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rbpms2 T A 9: 65,649,413 F45Y probably damaging Het
Rmdn3 T C 2: 119,146,424 D276G probably damaging Het
Sdccag3 G A 2: 26,384,766 A373V probably damaging Het
Sept2 T A 1: 93,499,308 I171K probably benign Het
Serpinb3a C A 1: 107,046,240 G314C probably damaging Het
Slc35f3 T A 8: 126,389,186 V284D possibly damaging Het
Snapc4 A G 2: 26,365,710 V934A probably benign Het
Tctn1 A G 5: 122,264,368 M1T probably null Het
Tgoln1 G A 6: 72,616,855 probably benign Het
Unc5c G A 3: 141,768,612 probably null Het
Vmn2r11 A T 5: 109,054,967 F81L probably benign Het
Vmn2r15 A T 5: 109,293,104 V296E probably benign Het
Vmn2r15 C T 5: 109,293,444 D183N probably damaging Het
Wdr34 A G 2: 30,033,874 V213A probably benign Het
Zfp763 T C 17: 33,033,320 probably benign Het
Other mutations in Hao2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Hao2 APN 3 98880332 splice site probably benign
IGL03279:Hao2 APN 3 98880396 missense possibly damaging 0.88
goatherd UTSW 3 98877135 missense probably benign 0.06
R0600:Hao2 UTSW 3 98883560 splice site probably benign
R1298:Hao2 UTSW 3 98883669 missense possibly damaging 0.94
R3176:Hao2 UTSW 3 98880328 splice site probably benign
R3177:Hao2 UTSW 3 98880328 splice site probably benign
R3786:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R4486:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4487:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4488:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R5290:Hao2 UTSW 3 98877177 missense probably damaging 0.99
R5760:Hao2 UTSW 3 98880432 nonsense probably null
R6129:Hao2 UTSW 3 98880526 missense probably benign 0.00
R6720:Hao2 UTSW 3 98877135 missense probably benign 0.06
R6861:Hao2 UTSW 3 98877182 missense probably damaging 1.00
R6991:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R7203:Hao2 UTSW 3 98877282 splice site probably null
R8515:Hao2 UTSW 3 98883647 missense probably benign 0.00
Z1088:Hao2 UTSW 3 98875352 missense probably damaging 1.00
Z1177:Hao2 UTSW 3 98881942 missense probably benign 0.02
Z1177:Hao2 UTSW 3 98882041 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCATCCTTAAGATCCATAGGC -3'
(R):5'- TGCTCCAAATGCACCTCATC -3'

Sequencing Primer
(F):5'- CCATAGGCAATATCATGATAAGGC -3'
(R):5'- GCATTCATTTGGGTCTAAGAGTCATC -3'
Posted On2020-07-28