Incidental Mutation 'R8286:Adam26b'
ID638460
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8286 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43519961 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 668 (N668I)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably benign
Transcript: ENSMUST00000080135
AA Change: N668I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: N668I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik C T 1: 9,613,388 T67I probably benign Het
4930402H24Rik T C 2: 130,717,328 I937V probably damaging Het
Abcb1b A T 5: 8,864,119 Y1163F probably damaging Het
Abcd4 A G 12: 84,603,146 V589A probably benign Het
Atp2b2 T C 6: 113,842,314 N6S possibly damaging Het
BC021891 T A 8: 125,910,759 M28K probably benign Het
Cacna2d2 A G 9: 107,514,864 Y468C probably damaging Het
Cngb1 A T 8: 95,275,624 V52D Het
Cped1 A T 6: 22,254,602 Y998F probably benign Het
Csmd1 A G 8: 15,989,188 V2390A probably benign Het
Ctsj A T 13: 61,000,516 C321* probably null Het
Dip2a A C 10: 76,286,463 I139S probably benign Het
Eif1 A G 11: 100,319,969 probably benign Het
Exoc1 T C 5: 76,563,240 I662T probably benign Het
Flt4 A G 11: 49,637,262 R971G probably benign Het
Hecw2 T C 1: 53,840,769 T1294A probably damaging Het
Herc2 T G 7: 56,229,662 V4676G possibly damaging Het
Hif1a A G 12: 73,945,248 probably benign Het
Icam5 C A 9: 21,035,526 A450E possibly damaging Het
Mars C A 10: 127,305,479 R347L probably benign Het
Mctp1 A T 13: 76,757,055 I426F probably benign Het
Mdn1 T C 4: 32,731,960 S3007P possibly damaging Het
Mical3 T C 6: 121,021,188 R65G possibly damaging Het
Ncald G T 15: 37,397,261 Y58* probably null Het
Neil2 A T 14: 63,188,705 I72K probably benign Het
Olfr1056 A G 2: 86,356,347 F12L probably damaging Het
Olfr881 C A 9: 37,993,105 Y204* probably null Het
Pan2 A G 10: 128,318,320 D1086G probably damaging Het
Plxnb1 A G 9: 109,106,802 T1087A probably damaging Het
Prpf39 A G 12: 65,056,358 M469V probably benign Het
Ptprk A T 10: 28,568,327 S905C probably damaging Het
Rassf5 T C 1: 131,212,330 D164G possibly damaging Het
Setd1a T C 7: 127,786,184 W688R possibly damaging Het
Sfswap C T 5: 129,539,719 T409I probably damaging Het
Slc50a1 G A 3: 89,270,403 probably benign Het
Slfn9 G C 11: 82,981,269 N880K probably damaging Het
Sprr1b T C 3: 92,437,413 K52R probably benign Het
Tfb2m T C 1: 179,529,205 D388G probably damaging Het
Tmem234 T C 4: 129,607,088 probably benign Het
Traj43 A G 14: 54,174,744 N1D Het
Trmt1l T A 1: 151,457,792 I682N probably damaging Het
Trp53rka T C 2: 165,491,525 D148G probably damaging Het
Vmn2r86 A G 10: 130,449,986 V440A probably benign Het
Wdfy3 C T 5: 101,937,421 V736I probably benign Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7596:Adam26b UTSW 8 43520200 missense probably benign
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7769:Adam26b UTSW 8 43521695 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7918:Adam26b UTSW 8 43521101 missense probably benign 0.14
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTCCTTCGTTAGAGTCACGC -3'
(R):5'- ACAGAAAGTGTGTCAGCAAGTCTG -3'

Sequencing Primer
(F):5'- CTATTGAGAAGGGTGTTGTTTCCC -3'
(R):5'- TCAGCAAGTCTGATCTGGTAAG -3'
Posted On2020-07-28