Incidental Mutation 'R8286:Hecw2'
ID638441
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
SynonymsA730039N16Rik, Nedl2, D030049F17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R8286 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53806876-54195168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53840769 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1294 (T1294A)
Ref Sequence ENSEMBL: ENSMUSP00000084942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
Predicted Effect probably damaging
Transcript: ENSMUST00000087659
AA Change: T1294A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: T1294A

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120904
AA Change: T1294A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: T1294A

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik C T 1: 9,613,388 T67I probably benign Het
4930402H24Rik T C 2: 130,717,328 I937V probably damaging Het
Abcb1b A T 5: 8,864,119 Y1163F probably damaging Het
Abcd4 A G 12: 84,603,146 V589A probably benign Het
Adam26b T A 8: 43,519,961 N668I probably benign Het
Atp2b2 T C 6: 113,842,314 N6S possibly damaging Het
BC021891 T A 8: 125,910,759 M28K probably benign Het
Cacna2d2 A G 9: 107,514,864 Y468C probably damaging Het
Cngb1 A T 8: 95,275,624 V52D Het
Cped1 A T 6: 22,254,602 Y998F probably benign Het
Csmd1 A G 8: 15,989,188 V2390A probably benign Het
Ctsj A T 13: 61,000,516 C321* probably null Het
Dip2a A C 10: 76,286,463 I139S probably benign Het
Eif1 A G 11: 100,319,969 probably benign Het
Exoc1 T C 5: 76,563,240 I662T probably benign Het
Flt4 A G 11: 49,637,262 R971G probably benign Het
Herc2 T G 7: 56,229,662 V4676G possibly damaging Het
Hif1a A G 12: 73,945,248 probably benign Het
Icam5 C A 9: 21,035,526 A450E possibly damaging Het
Mars C A 10: 127,305,479 R347L probably benign Het
Mctp1 A T 13: 76,757,055 I426F probably benign Het
Mdn1 T C 4: 32,731,960 S3007P possibly damaging Het
Mical3 T C 6: 121,021,188 R65G possibly damaging Het
Ncald G T 15: 37,397,261 Y58* probably null Het
Neil2 A T 14: 63,188,705 I72K probably benign Het
Olfr1056 A G 2: 86,356,347 F12L probably damaging Het
Olfr881 C A 9: 37,993,105 Y204* probably null Het
Pan2 A G 10: 128,318,320 D1086G probably damaging Het
Plxnb1 A G 9: 109,106,802 T1087A probably damaging Het
Prpf39 A G 12: 65,056,358 M469V probably benign Het
Ptprk A T 10: 28,568,327 S905C probably damaging Het
Rassf5 T C 1: 131,212,330 D164G possibly damaging Het
Setd1a T C 7: 127,786,184 W688R possibly damaging Het
Sfswap C T 5: 129,539,719 T409I probably damaging Het
Slc50a1 G A 3: 89,270,403 probably benign Het
Slfn9 G C 11: 82,981,269 N880K probably damaging Het
Sprr1b T C 3: 92,437,413 K52R probably benign Het
Tfb2m T C 1: 179,529,205 D388G probably damaging Het
Tmem234 T C 4: 129,607,088 probably benign Het
Traj43 A G 14: 54,174,744 N1D Het
Trmt1l T A 1: 151,457,792 I682N probably damaging Het
Trp53rka T C 2: 165,491,525 D148G probably damaging Het
Vmn2r86 A G 10: 130,449,986 V440A probably benign Het
Wdfy3 C T 5: 101,937,421 V736I probably benign Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 splice site probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54040387 missense probably benign 0.37
R8300:Hecw2 UTSW 1 53887616 missense probably null 0.07
R8362:Hecw2 UTSW 1 54040491 start codon destroyed probably null 0.51
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGGGCTGCCTGTAGAATTAG -3'
(R):5'- CTGTAGTGAGCATCCTCTACAATG -3'

Sequencing Primer
(F):5'- GCCTGTAGAATTAGGTTTGACAAGC -3'
(R):5'- GTGAGCATCCTCTACAATGTTAAAC -3'
Posted On2020-07-28