Incidental Mutation 'R8303:Smpd4'
ID639351
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Namesphingomyelin phosphodiesterase 4
Synonyms4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8303 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17619354-17644828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17639331 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 384 (F384L)
Ref Sequence ENSEMBL: ENSMUSP00000006053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000163997] [ENSMUST00000165363] [ENSMUST00000167217] [ENSMUST00000170117] [ENSMUST00000170273] [ENSMUST00000170366] [ENSMUST00000170996]
Predicted Effect probably damaging
Transcript: ENSMUST00000006053
AA Change: F384L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899
AA Change: F384L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090159
AA Change: F355L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899
AA Change: F355L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163476
AA Change: F355L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899
AA Change: F355L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163997
AA Change: F134L
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899
AA Change: F134L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165363
AA Change: F355L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899
AA Change: F355L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167217
SMART Domains Protein: ENSMUSP00000130570
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 92 3.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170117
SMART Domains Protein: ENSMUSP00000132279
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 46 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170273
AA Change: F282L
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899
AA Change: F282L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170366
AA Change: F355L
SMART Domains Protein: ENSMUSP00000130990
Gene: ENSMUSG00000005899
AA Change: F355L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.1e-177 PFAM
Pfam:mit_SMPDase 286 643 1.8e-214 PFAM
Pfam:mit_SMPDase 642 696 8.6e-18 PFAM
transmembrane domain 697 719 N/A INTRINSIC
transmembrane domain 726 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170996
AA Change: F60L
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899
AA Change: F60L

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,721 E114G probably benign Het
2810021J22Rik T A 11: 58,880,140 D149E probably benign Het
Aars2 T C 17: 45,507,597 C103R probably damaging Het
Aass T C 6: 23,092,368 D591G probably benign Het
Arhgap32 A G 9: 32,260,909 T1662A probably benign Het
Arhgap42 A T 9: 9,009,326 I520N probably damaging Het
Arhgef3 T C 14: 27,394,138 I279T probably damaging Het
Arid4b A G 13: 14,120,223 K30R probably damaging Het
Asxl3 C T 18: 22,524,416 R1828W probably benign Het
Bid T C 6: 120,900,239 Y47C probably benign Het
Card6 T C 15: 5,105,365 T119A probably benign Het
Cbr1 T C 16: 93,610,017 I207T probably damaging Het
Cep135 T C 5: 76,611,728 L443P probably damaging Het
Cfap43 T A 19: 47,765,835 R1017* probably null Het
Cfap52 T A 11: 67,939,795 S280C probably benign Het
Cntnap5b T C 1: 100,141,297 F81L probably damaging Het
Cyp4a12a A G 4: 115,328,933 D430G probably damaging Het
Cyp4f37 G A 17: 32,634,178 probably null Het
Dclre1a A G 19: 56,542,689 S742P probably damaging Het
Ddx54 T C 5: 120,621,790 F414S probably damaging Het
Dsp A G 13: 38,197,343 N2688S probably benign Het
Elovl4 A T 9: 83,788,267 probably null Het
Erbin A C 13: 103,830,186 probably null Het
Fsip2 A G 2: 82,988,380 D4819G probably benign Het
Gapvd1 G A 2: 34,712,200 P645L probably damaging Het
Gbp9 T C 5: 105,081,305 E492G possibly damaging Het
Gpc5 T A 14: 115,428,255 I497K probably benign Het
Hlx A G 1: 184,727,708 L411P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ice1 A T 13: 70,606,407 I520N probably benign Het
Ist1 T C 8: 109,683,780 probably null Het
Itga3 T C 11: 95,062,640 D292G probably benign Het
Kif21a T C 15: 90,971,196 N655S probably damaging Het
Lrrtm1 A G 6: 77,244,679 H373R probably benign Het
Ngdn A T 14: 55,023,145 H270L probably benign Het
Nol4 G A 18: 23,040,174 probably benign Het
Nxpe5 G A 5: 138,241,002 probably benign Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr26 A C 9: 38,855,541 T160P probably damaging Het
Olfr347 A G 2: 36,734,455 I45V probably damaging Het
Olfr948 A C 9: 39,319,393 S74A probably damaging Het
Pask C A 1: 93,320,564 R1005L probably benign Het
Pcm1 A G 8: 41,283,721 T875A probably damaging Het
Pdrg1 A T 2: 153,009,667 I130N probably damaging Het
Plec A T 15: 76,189,266 M448K unknown Het
R3hdml T G 2: 163,499,912 V204G probably damaging Het
Rasa4 G A 5: 136,089,381 V32M possibly damaging Het
Scaf8 T C 17: 3,148,552 V44A unknown Het
Smad3 G T 9: 63,667,478 P177T probably benign Het
Sycp2l G C 13: 41,129,799 L170F probably damaging Het
Tas2r107 T C 6: 131,659,622 S155G probably benign Het
Tmem143 T A 7: 45,916,570 M439K probably benign Het
Ttc41 A T 10: 86,719,630 T317S probably benign Het
Umps A G 16: 33,963,870 V71A possibly damaging Het
Usp17lc G A 7: 103,418,182 G228D possibly damaging Het
Usp17ld C T 7: 103,250,816 C303Y probably damaging Het
Vmn2r65 C A 7: 84,940,183 E842* probably null Het
Vmn2r94 A G 17: 18,244,171 F619S probably damaging Het
Vps13a T C 19: 16,616,906 T3154A probably benign Het
Vps13b C T 15: 35,639,917 T1311I probably damaging Het
Wdr66 T A 5: 123,322,587 V1204E probably damaging Het
Xpot A T 10: 121,611,500 Y353* probably null Het
Zfp319 A T 8: 95,329,137 L146Q probably damaging Het
Zfp422 T A 6: 116,626,651 H129L probably damaging Het
Zzef1 T C 11: 72,917,189 F2709L probably damaging Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17642757 missense probably benign 0.04
IGL01461:Smpd4 APN 16 17621506 missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17626518 missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17639351 missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17625807 nonsense probably null
Victim UTSW 16 17640971 missense probably damaging 1.00
weakling UTSW 16 17638486 intron probably benign
G1citation:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R0197:Smpd4 UTSW 16 17641597 critical splice donor site probably null
R0549:Smpd4 UTSW 16 17639312 missense probably benign 0.15
R0789:Smpd4 UTSW 16 17625826 missense probably benign 0.14
R1077:Smpd4 UTSW 16 17623969 missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17638486 intron probably benign
R1716:Smpd4 UTSW 16 17642501 missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17626008 missense probably damaging 0.99
R1758:Smpd4 UTSW 16 17640880 missense probably damaging 1.00
R1838:Smpd4 UTSW 16 17642302 splice site probably null
R2115:Smpd4 UTSW 16 17626865 missense probably benign 0.33
R2849:Smpd4 UTSW 16 17642212 missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17642128 intron probably benign
R6157:Smpd4 UTSW 16 17641066 splice site probably null
R6190:Smpd4 UTSW 16 17632013 missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R7062:Smpd4 UTSW 16 17640971 missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17641783 missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17638633 missense probably damaging 1.00
R7853:Smpd4 UTSW 16 17642741 missense probably damaging 1.00
R8187:Smpd4 UTSW 16 17629135 missense probably damaging 1.00
R8518:Smpd4 UTSW 16 17641020 missense possibly damaging 0.89
R8735:Smpd4 UTSW 16 17635546 missense possibly damaging 0.92
Z1176:Smpd4 UTSW 16 17619586 intron probably benign
Z1177:Smpd4 UTSW 16 17621441 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GGTTTCTTCTGGAGAATCAGGC -3'
(R):5'- GCTGAGTATGGCCAACAGAAC -3'

Sequencing Primer
(F):5'- CAAATCTTACCTCAGGGAGTGTG -3'
(R):5'- TATGGCCAACAGAACGACAAG -3'
Posted On2020-07-28