Incidental Mutation 'R8321:Gfm1'
ID641941
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene NameG elongation factor, mitochondrial 1
SynonymsD3Wsu133e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8321 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location67430096-67476529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67430261 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 8 (A8V)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077271]
AlphaFold Q8K0D5
Predicted Effect probably benign
Transcript: ENSMUST00000077271
AA Change: A8V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: A8V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G T 9: 35,909,453 C111F probably damaging Het
Arhgap44 A G 11: 65,008,227 V708A probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Bank1 T A 3: 136,234,634 E329V possibly damaging Het
Cdh11 T C 8: 102,634,784 R641G probably damaging Het
Cfap58 A G 19: 47,958,147 E373G probably damaging Het
Chd8 T C 14: 52,232,567 T529A probably benign Het
Chtf18 G A 17: 25,720,891 T747I probably benign Het
Cyp2j6 A G 4: 96,553,447 L2P probably benign Het
Cyp4f18 G A 8: 71,988,583 P518S possibly damaging Het
Dmrtc1a G A X: 102,908,615 R8W probably benign Het
Dpyd T C 3: 118,781,924 V137A possibly damaging Het
Epha6 A G 16: 59,915,954 V739A probably damaging Het
Ern2 C T 7: 122,173,208 A676T probably damaging Het
Fam20c A T 5: 138,757,931 I241F possibly damaging Het
Fastkd2 A G 1: 63,747,979 H524R probably benign Het
Foxq1 T C 13: 31,559,268 Y118H probably damaging Het
Gfm2 C T 13: 97,162,992 T407M possibly damaging Het
Gldc G A 19: 30,143,407 Q375* probably null Het
Gm29096 C A 10: 41,634,033 A859S probably damaging Het
Gm5114 A G 7: 39,410,849 I192T possibly damaging Het
Gnb1 A T 4: 155,555,025 N237I possibly damaging Het
Herc2 C T 7: 56,229,348 P4662S possibly damaging Het
Herc3 C T 6: 58,843,769 S46F possibly damaging Het
Hgsnat C T 8: 25,971,151 G153E possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Invs T A 4: 48,283,267 D6E probably benign Het
Jakmip3 T C 7: 139,026,884 V463A probably benign Het
Jarid2 T A 13: 44,848,386 S96R probably damaging Het
Krtap6-1 A C 16: 89,031,736 N7H unknown Het
Matn4 A T 2: 164,393,287 V455D probably damaging Het
Nbea G A 3: 56,183,097 P47S possibly damaging Het
Oit3 T C 10: 59,428,160 H384R probably benign Het
Olfr387-ps1 G A 11: 73,665,536 R309H unknown Het
Olfr901 A T 9: 38,430,554 I91F probably damaging Het
Pabpc4l T A 3: 46,446,294 D305V probably damaging Het
Papln G A 12: 83,774,941 W314* probably null Het
Pask G A 1: 93,320,655 R975C possibly damaging Het
Plce1 A G 19: 38,651,936 N542S probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rnf17 TG T 14: 56,424,542 132 probably null Het
Sez6l2 C A 7: 126,958,416 T334N probably damaging Het
Sh3d19 A G 3: 86,093,764 T256A probably damaging Het
Slit2 A T 5: 48,230,267 N545Y probably damaging Het
Sprtn A T 8: 124,903,255 D429V possibly damaging Het
Srcap T C 7: 127,540,896 V1389A probably damaging Het
Tecta C A 9: 42,373,053 C912F probably damaging Het
Tns1 T A 1: 73,985,780 probably null Het
Tprgl A G 4: 154,160,403 V76A probably benign Het
Trav12-2 G T 14: 53,616,383 probably benign Het
Trio T C 15: 27,881,326 D612G possibly damaging Het
Usp6nl A T 2: 6,391,089 Q36H possibly damaging Het
Vps9d1 A T 8: 123,248,805 M167K possibly damaging Het
Zfhx4 T A 3: 5,401,127 L2140Q probably damaging Het
Zfp512b A G 2: 181,587,138 V678A possibly damaging Het
Zfp800 A G 6: 28,242,993 S658P probably damaging Het
Zscan22 A G 7: 12,903,698 S6G probably benign Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67438560 missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67474753 missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67443658 missense probably benign 0.09
IGL01738:Gfm1 APN 3 67456661 missense probably benign 0.15
IGL02679:Gfm1 APN 3 67474767 missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67474743 missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67457918 missense probably benign 0.00
R0815:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R0863:Gfm1 UTSW 3 67474595 missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67438644 missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67435610 missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67456585 missense probably benign 0.44
R2097:Gfm1 UTSW 3 67449746 missense probably damaging 0.97
R2149:Gfm1 UTSW 3 67474560 missense probably damaging 1.00
R2337:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67456700 missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67431720 missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67433398 missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67473544 missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67453727 critical splice donor site probably null
R5692:Gfm1 UTSW 3 67435622 missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67435562 missense probably benign 0.11
R6232:Gfm1 UTSW 3 67467882 missense possibly damaging 0.52
R6234:Gfm1 UTSW 3 67435514 missense probably damaging 1.00
R6514:Gfm1 UTSW 3 67473546 missense probably benign
R6911:Gfm1 UTSW 3 67451303 missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67440181 missense probably benign 0.30
R7899:Gfm1 UTSW 3 67473527 missense probably benign 0.10
R8465:Gfm1 UTSW 3 67431699 missense probably damaging 1.00
R8473:Gfm1 UTSW 3 67453718 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATGACACCTCCCTGTGACAATC -3'
(R):5'- CGGGGCACTTCTCTTTAAGG -3'

Sequencing Primer
(F):5'- TGTGACAATCCTCTGCATAAACTACG -3'
(R):5'- GGCACTTCTCTTTAAGGTAGATCATC -3'
Posted On2020-07-28