Mutagenetix > Incidental Mutation

Incidental Mutation 'R8321:Oit3'

641972

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.463) question?

Stock #

R8321 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59428160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 384 (H384R)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009798]

AlphaFold

Q8R4V5

Predicted Effect

probably benign
Transcript: ENSMUST00000009798
AA Change: H384R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: H384R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	G	T	9: 35,909,453	C111F	probably damaging	Het
Arhgap44	A	G	11: 65,008,227	V708A	probably benign	Het
Atg9a	G	A	1: 75,185,698	Q523*	probably null	Het
Bank1	T	A	3: 136,234,634	E329V	possibly damaging	Het
Ccdc162	C	A	10: 41,634,033	A859S	probably damaging	Het
Cdh11	T	C	8: 102,634,784	R641G	probably damaging	Het
Cfap58	A	G	19: 47,958,147	E373G	probably damaging	Het
Chd8	T	C	14: 52,232,567	T529A	probably benign	Het
Chtf18	G	A	17: 25,720,891	T747I	probably benign	Het
Cyp2j6	A	G	4: 96,553,447	L2P	probably benign	Het
Cyp4f18	G	A	8: 71,988,583	P518S	possibly damaging	Het
Dmrtc1a	G	A	X: 102,908,615	R8W	probably benign	Het
Dpyd	T	C	3: 118,781,924	V137A	possibly damaging	Het
Epha6	A	G	16: 59,915,954	V739A	probably damaging	Het
Ern2	C	T	7: 122,173,208	A676T	probably damaging	Het
Fam20c	A	T	5: 138,757,931	I241F	possibly damaging	Het
Fastkd2	A	G	1: 63,747,979	H524R	probably benign	Het
Foxq1	T	C	13: 31,559,268	Y118H	probably damaging	Het
Gfm1	C	T	3: 67,430,261	A8V	probably benign	Het
Gfm2	C	T	13: 97,162,992	T407M	possibly damaging	Het
Gldc	G	A	19: 30,143,407	Q375*	probably null	Het
Gm5114	A	G	7: 39,410,849	I192T	possibly damaging	Het
Gnb1	A	T	4: 155,555,025	N237I	possibly damaging	Het
Herc2	C	T	7: 56,229,348	P4662S	possibly damaging	Het
Herc3	C	T	6: 58,843,769	S46F	possibly damaging	Het
Hgsnat	C	T	8: 25,971,151	G153E	possibly damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Invs	T	A	4: 48,283,267	D6E	probably benign	Het
Jakmip3	T	C	7: 139,026,884	V463A	probably benign	Het
Jarid2	T	A	13: 44,848,386	S96R	probably damaging	Het
Krtap6-1	A	C	16: 89,031,736	N7H	unknown	Het
Matn4	A	T	2: 164,393,287	V455D	probably damaging	Het
Nbea	G	A	3: 56,183,097	P47S	possibly damaging	Het
Olfr387-ps1	G	A	11: 73,665,536	R309H	unknown	Het
Olfr901	A	T	9: 38,430,554	I91F	probably damaging	Het
Pabpc4l	T	A	3: 46,446,294	D305V	probably damaging	Het
Papln	G	A	12: 83,774,941	W314*	probably null	Het
Pask	G	A	1: 93,320,655	R975C	possibly damaging	Het
Plce1	A	G	19: 38,651,936	N542S	probably benign	Het
Rasal1	C	T	5: 120,666,355	R431C	probably benign	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sez6l2	C	A	7: 126,958,416	T334N	probably damaging	Het
Sh3d19	A	G	3: 86,093,764	T256A	probably damaging	Het
Slit2	A	T	5: 48,230,267	N545Y	probably damaging	Het
Sprtn	A	T	8: 124,903,255	D429V	possibly damaging	Het
Srcap	T	C	7: 127,540,896	V1389A	probably damaging	Het
Tecta	C	A	9: 42,373,053	C912F	probably damaging	Het
Tns1	T	A	1: 73,985,780		probably null	Het
Tprgl	A	G	4: 154,160,403	V76A	probably benign	Het
Trav12-2	G	T	14: 53,616,383		probably benign	Het
Trio	T	C	15: 27,881,326	D612G	possibly damaging	Het
Usp6nl	A	T	2: 6,391,089	Q36H	possibly damaging	Het
Vps9d1	A	T	8: 123,248,805	M167K	possibly damaging	Het
Zfhx4	T	A	3: 5,401,127	L2140Q	probably damaging	Het
Zfp512b	A	G	2: 181,587,138	V678A	possibly damaging	Het
Zfp800	A	G	6: 28,242,993	S658P	probably damaging	Het
Zscan22	A	G	7: 12,903,698	S6G	probably benign	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0567:Oit3	UTSW	10	59435978	missense	probably damaging	0.99
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R3103:Oit3	UTSW	10	59438891	missense	probably damaging	0.98
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4415:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4416:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6766:Oit3	UTSW	10	59438712	missense	probably damaging	0.99
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7495:Oit3	UTSW	10	59423943	missense	possibly damaging	0.74
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8919:Oit3	UTSW	10	59441646	missense	unknown
R9131:Oit3	UTSW	10	59435929	missense	probably benign	0.01
R9457:Oit3	UTSW	10	59441683	start codon destroyed	unknown
R9478:Oit3	UTSW	10	59438642	missense	probably damaging	0.99
R9502:Oit3	UTSW	10	59428351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGATCAGGTAGTACTTGAGG -3'
(R):5'- AATGACAAAATCGTGGCCAGC -3'

Sequencing Primer
(F):5'- ATCCATCTTTGCAGTGGGC -3'
(R):5'- TGGCCAGCAACATCGTGAC -3'

Posted On

2020-07-28