Incidental Mutation 'R8321:Dpyd'
ID 641943
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8321 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118781924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect possibly damaging
Transcript: ENSMUST00000039177
AA Change: V137A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: V137A

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G T 9: 35,909,453 C111F probably damaging Het
Arhgap44 A G 11: 65,008,227 V708A probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Bank1 T A 3: 136,234,634 E329V possibly damaging Het
Cdh11 T C 8: 102,634,784 R641G probably damaging Het
Cfap58 A G 19: 47,958,147 E373G probably damaging Het
Chd8 T C 14: 52,232,567 T529A probably benign Het
Chtf18 G A 17: 25,720,891 T747I probably benign Het
Cyp2j6 A G 4: 96,553,447 L2P probably benign Het
Cyp4f18 G A 8: 71,988,583 P518S possibly damaging Het
Dmrtc1a G A X: 102,908,615 R8W probably benign Het
Epha6 A G 16: 59,915,954 V739A probably damaging Het
Ern2 C T 7: 122,173,208 A676T probably damaging Het
Fam20c A T 5: 138,757,931 I241F possibly damaging Het
Fastkd2 A G 1: 63,747,979 H524R probably benign Het
Foxq1 T C 13: 31,559,268 Y118H probably damaging Het
Gfm1 C T 3: 67,430,261 A8V probably benign Het
Gfm2 C T 13: 97,162,992 T407M possibly damaging Het
Gldc G A 19: 30,143,407 Q375* probably null Het
Gm29096 C A 10: 41,634,033 A859S probably damaging Het
Gm5114 A G 7: 39,410,849 I192T possibly damaging Het
Gnb1 A T 4: 155,555,025 N237I possibly damaging Het
Herc2 C T 7: 56,229,348 P4662S possibly damaging Het
Herc3 C T 6: 58,843,769 S46F possibly damaging Het
Hgsnat C T 8: 25,971,151 G153E possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igkv2-137 GA GAA 6: 67,556,170 probably null Het
Invs T A 4: 48,283,267 D6E probably benign Het
Jakmip3 T C 7: 139,026,884 V463A probably benign Het
Jarid2 T A 13: 44,848,386 S96R probably damaging Het
Krtap6-1 A C 16: 89,031,736 N7H unknown Het
Matn4 A T 2: 164,393,287 V455D probably damaging Het
Nbea G A 3: 56,183,097 P47S possibly damaging Het
Oit3 T C 10: 59,428,160 H384R probably benign Het
Olfr387-ps1 G A 11: 73,665,536 R309H unknown Het
Olfr901 A T 9: 38,430,554 I91F probably damaging Het
Pabpc4l T A 3: 46,446,294 D305V probably damaging Het
Papln G A 12: 83,774,941 W314* probably null Het
Pask G A 1: 93,320,655 R975C possibly damaging Het
Plce1 A G 19: 38,651,936 N542S probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rnf17 TG T 14: 56,424,542 132 probably null Het
Sez6l2 C A 7: 126,958,416 T334N probably damaging Het
Sh3d19 A G 3: 86,093,764 T256A probably damaging Het
Slit2 A T 5: 48,230,267 N545Y probably damaging Het
Sprtn A T 8: 124,903,255 D429V possibly damaging Het
Srcap T C 7: 127,540,896 V1389A probably damaging Het
Tecta C A 9: 42,373,053 C912F probably damaging Het
Tns1 T A 1: 73,985,780 probably null Het
Tprgl A G 4: 154,160,403 V76A probably benign Het
Trav12-2 G T 14: 53,616,383 probably benign Het
Trio T C 15: 27,881,326 D612G possibly damaging Het
Usp6nl A T 2: 6,391,089 Q36H possibly damaging Het
Vps9d1 A T 8: 123,248,805 M167K possibly damaging Het
Zfhx4 T A 3: 5,401,127 L2140Q probably damaging Het
Zfp512b A G 2: 181,587,138 V678A possibly damaging Het
Zfp800 A G 6: 28,242,993 S658P probably damaging Het
Zscan22 A G 7: 12,903,698 S6G probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGAACACCAGTGCAGCATG -3'
(R):5'- CACTGAAACACATACAAATGTTGGG -3'

Sequencing Primer
(F):5'- CCAGTGCAGCATGTACATCATATTTG -3'
(R):5'- TGGGTATCAACAAAAAGAAAACCAAG -3'
Posted On 2020-07-28