Incidental Mutation 'R8327:Reep2'
ID 644180
Institutional Source Beutler Lab
Gene Symbol Reep2
Ensembl Gene ENSMUSG00000038555
Gene Name receptor accessory protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R8327 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34840589-34847463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34842513 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 31 (N31S)
Ref Sequence ENSEMBL: ENSMUSP00000036065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043484] [ENSMUST00000043775] [ENSMUST00000225195]
AlphaFold Q8VCD6
Predicted Effect probably damaging
Transcript: ENSMUST00000043484
AA Change: N31S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036065
Gene: ENSMUSG00000038555
AA Change: N31S

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.4e-36 PFAM
low complexity region 129 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043775
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225195
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik C T 14: 49,232,899 G197S possibly damaging Het
2900026A02Rik T A 5: 113,183,819 D843V possibly damaging Het
6330409D20Rik T A 2: 32,737,611 Q111L unknown Het
Abcc5 C A 16: 20,422,318 R39L probably benign Het
Acbd3 C A 1: 180,738,593 Q284K probably damaging Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Apc2 T G 10: 80,301,930 D68E probably damaging Het
Apob A T 12: 8,001,015 I1093F possibly damaging Het
Arid2 T A 15: 96,362,604 D411E probably damaging Het
Astn1 T A 1: 158,609,280 Y811N probably damaging Het
Ccdc187 T C 2: 26,280,618 H616R probably benign Het
Clca4b T C 3: 144,922,001 Y403C possibly damaging Het
Dagla C T 19: 10,251,087 V656I probably benign Het
Dguok A C 6: 83,487,079 W166G probably damaging Het
Dlg5 G A 14: 24,146,320 A1603V probably damaging Het
Fam26e A C 10: 34,096,068 F124V probably damaging Het
Fanca G A 8: 123,313,245 Q138* probably null Het
Fbxl19 T A 7: 127,748,348 C25* probably null Het
Gm340 C T 19: 41,582,557 S63L probably damaging Het
Gm49383 C A 12: 69,196,869 E79* probably null Het
Lrp2 T C 2: 69,491,924 Y1887C probably damaging Het
Mast3 T C 8: 70,779,418 D1305G probably damaging Het
Mreg C A 1: 72,164,098 R107L possibly damaging Het
Nbn T A 4: 15,981,470 S521T probably benign Het
Nxpe2 C A 9: 48,319,759 V437L probably benign Het
Olfr331 T C 11: 58,502,116 M153V probably benign Het
Olfr571 A T 7: 102,909,719 I40N probably damaging Het
Olfr891 T C 9: 38,179,890 E311G possibly damaging Het
Pcdhb5 A C 18: 37,320,900 K111T probably benign Het
Pi4kb A G 3: 94,998,881 I580V probably benign Het
Pla2g16 T C 19: 7,579,149 L105P probably benign Het
Rbm15b A G 9: 106,884,447 S841P probably benign Het
Scmh1 C T 4: 120,522,502 H505Y probably benign Het
Setd1a T A 7: 127,791,497 L1115H unknown Het
Slc26a3 A G 12: 31,466,431 D596G possibly damaging Het
Smg5 G T 3: 88,345,407 A167S probably damaging Het
Supv3l1 T C 10: 62,441,225 T255A probably damaging Het
Synrg G A 11: 84,008,905 A568T probably benign Het
Tmem132a G T 19: 10,858,947 P740T probably benign Het
Tmem181a T C 17: 6,301,405 L353P probably damaging Het
Tubgcp3 T C 8: 12,654,343 E242G probably benign Het
Vmn2r77 A T 7: 86,801,472 T189S probably benign Het
Zfp638 T G 6: 83,928,697 L44W probably damaging Het
Zfp715 G A 7: 43,298,058 T826I possibly damaging Het
Zfp865 G A 7: 5,031,059 S681N probably benign Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Reep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Reep2 APN 18 34846249 missense probably benign
IGL02244:Reep2 APN 18 34840754 unclassified probably benign
R0624:Reep2 UTSW 18 34840771 missense probably benign 0.02
R2005:Reep2 UTSW 18 34845621 missense probably damaging 1.00
R2910:Reep2 UTSW 18 34845690 critical splice donor site probably null
R2911:Reep2 UTSW 18 34845690 critical splice donor site probably null
R5642:Reep2 UTSW 18 34846218 missense probably benign
R6709:Reep2 UTSW 18 34846210 missense probably benign 0.10
R7029:Reep2 UTSW 18 34845289 missense probably null 0.22
R8944:Reep2 UTSW 18 34842876 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACACGTGTGTAGCTCCAAAG -3'
(R):5'- TACCCAAGGCCTCACACTTG -3'

Sequencing Primer
(F):5'- ATAGTCCTTGACCAGAGTTCCTCAG -3'
(R):5'- TTGCCAATCATACCAAGCCTG -3'
Posted On 2020-09-02