Incidental Mutation 'R8353:Scfd1'
ID645635
Institutional Source Beutler Lab
Gene Symbol Scfd1
Ensembl Gene ENSMUSG00000020952
Gene NameSec1 family domain containing 1
Synonyms3110021P21Rik, RA410, STXBP1L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8353 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51377510-51450101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 51412591 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 312 (K312Q)
Ref Sequence ENSEMBL: ENSMUSP00000021335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335] [ENSMUST00000219434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021335
AA Change: K312Q

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952
AA Change: K312Q

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219434
AA Change: K312Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mmrn1 T A 6: 60,988,377 Y1131N probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Opa1 G A 16: 29,620,868 R755H probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Rps6ka2 A G 17: 7,246,752 N117D probably benign Het
Sars G A 3: 108,428,713 S331L probably benign Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Stxbp5 A T 10: 9,809,048 V536E probably benign Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tmem115 T C 9: 107,534,798 V107A probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Scfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Scfd1 APN 12 51427869 missense probably benign 0.01
IGL00640:Scfd1 APN 12 51389315 missense probably benign 0.12
IGL01481:Scfd1 APN 12 51384120 missense probably damaging 0.99
IGL01585:Scfd1 APN 12 51415553 missense probably damaging 1.00
IGL01862:Scfd1 APN 12 51445711 missense probably damaging 1.00
IGL02000:Scfd1 APN 12 51414117 missense probably benign 0.03
IGL02226:Scfd1 APN 12 51389381 splice site probably benign
IGL02327:Scfd1 APN 12 51389317 missense possibly damaging 0.81
IGL02503:Scfd1 APN 12 51422921 missense possibly damaging 0.90
IGL02585:Scfd1 APN 12 51387107 missense probably damaging 0.97
IGL02732:Scfd1 APN 12 51422973 missense probably benign 0.01
R0671:Scfd1 UTSW 12 51412628 missense probably benign 0.01
R0707:Scfd1 UTSW 12 51412577 missense probably damaging 0.98
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1962:Scfd1 UTSW 12 51422986 missense probably benign 0.00
R2173:Scfd1 UTSW 12 51387079 missense probably benign 0.22
R2249:Scfd1 UTSW 12 51415516 missense possibly damaging 0.48
R3872:Scfd1 UTSW 12 51392196 missense probably damaging 0.98
R4080:Scfd1 UTSW 12 51431519 missense probably benign
R4356:Scfd1 UTSW 12 51439285 missense probably benign 0.00
R4841:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4842:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4909:Scfd1 UTSW 12 51390412 missense probably benign 0.00
R5004:Scfd1 UTSW 12 51444994 missense probably benign 0.03
R5275:Scfd1 UTSW 12 51415589 missense probably benign 0.19
R5494:Scfd1 UTSW 12 51396739 splice site probably null
R5779:Scfd1 UTSW 12 51431529 missense probably benign
R6000:Scfd1 UTSW 12 51445674 missense possibly damaging 0.55
R6017:Scfd1 UTSW 12 51445678 missense probably damaging 1.00
R6522:Scfd1 UTSW 12 51431541 missense probably benign 0.04
R6954:Scfd1 UTSW 12 51427946 critical splice donor site probably null
R7748:Scfd1 UTSW 12 51389357 missense probably benign 0.21
R7993:Scfd1 UTSW 12 51445707 missense probably damaging 1.00
R8122:Scfd1 UTSW 12 51433269 missense possibly damaging 0.95
R8453:Scfd1 UTSW 12 51412591 missense possibly damaging 0.91
R8890:Scfd1 UTSW 12 51427895 missense not run
RF007:Scfd1 UTSW 12 51422973 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACACTAATTGCCTTGTC -3'
(R):5'- GTGAGCTTCTGAAGAGATGATGC -3'

Sequencing Primer
(F):5'- TTGTCTAGGAAACATGGCTCC -3'
(R):5'- GGAGCAATACTGACACTCATCTGTG -3'
Posted On2020-09-02