Incidental Mutation 'R8353:Sh2b1'
ID645611
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene NameSH2B adaptor protein 1
SynonymsIrip, SH2-Bb, SH2-B, Sh2bpsm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R8353 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location126466994-126475424 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC at 126467570 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206664]
Predicted Effect probably benign
Transcript: ENSMUST00000032974
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032978
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205340
Predicted Effect probably benign
Transcript: ENSMUST00000205440
Predicted Effect probably benign
Transcript: ENSMUST00000205497
Predicted Effect probably benign
Transcript: ENSMUST00000205733
Predicted Effect probably benign
Transcript: ENSMUST00000205889
Predicted Effect probably benign
Transcript: ENSMUST00000206664
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mmrn1 T A 6: 60,988,377 Y1131N probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Opa1 G A 16: 29,620,868 R755H probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Rps6ka2 A G 17: 7,246,752 N117D probably benign Het
Sars G A 3: 108,428,713 S331L probably benign Het
Scfd1 A C 12: 51,412,591 K312Q possibly damaging Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Stxbp5 A T 10: 9,809,048 V536E probably benign Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tmem115 T C 9: 107,534,798 V107A probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126471292 missense probably benign 0.15
R8005:Sh2b1 UTSW 7 126469307 missense possibly damaging 0.82
R8356:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467600 nonsense probably null
R8683:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R8906:Sh2b1 UTSW 7 126471120 critical splice donor site probably null
R8921:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8921:Sh2b1 UTSW 7 126467581 utr 3 prime probably benign
R8922:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
Z1176:Sh2b1 UTSW 7 126467731 missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126471123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGTATCTCACACAAATGAG -3'
(R):5'- TCCACAAGCAATGTCTTCTCAC -3'

Sequencing Primer
(F):5'- CAGGTATCTCACACAAATGAGTACTG -3'
(R):5'- ACAAGCAATGTCTTCTCACCATTC -3'
Posted On2020-09-02