Incidental Mutation 'R6954:Scfd1'
ID541385
Institutional Source Beutler Lab
Gene Symbol Scfd1
Ensembl Gene ENSMUSG00000020952
Gene NameSec1 family domain containing 1
Synonyms3110021P21Rik, RA410, STXBP1L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51377510-51450101 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51427946 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335] [ENSMUST00000021335]
Predicted Effect probably null
Transcript: ENSMUST00000021335
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021335
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218138
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Scfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Scfd1 APN 12 51427869 missense probably benign 0.01
IGL00640:Scfd1 APN 12 51389315 missense probably benign 0.12
IGL01481:Scfd1 APN 12 51384120 missense probably damaging 0.99
IGL01585:Scfd1 APN 12 51415553 missense probably damaging 1.00
IGL01862:Scfd1 APN 12 51445711 missense probably damaging 1.00
IGL02000:Scfd1 APN 12 51414117 missense probably benign 0.03
IGL02226:Scfd1 APN 12 51389381 splice site probably benign
IGL02327:Scfd1 APN 12 51389317 missense possibly damaging 0.81
IGL02503:Scfd1 APN 12 51422921 missense possibly damaging 0.90
IGL02585:Scfd1 APN 12 51387107 missense probably damaging 0.97
IGL02732:Scfd1 APN 12 51422973 missense probably benign 0.01
R0671:Scfd1 UTSW 12 51412628 missense probably benign 0.01
R0707:Scfd1 UTSW 12 51412577 missense probably damaging 0.98
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1467:Scfd1 UTSW 12 51431498 missense possibly damaging 0.49
R1962:Scfd1 UTSW 12 51422986 missense probably benign 0.00
R2173:Scfd1 UTSW 12 51387079 missense probably benign 0.22
R2249:Scfd1 UTSW 12 51415516 missense possibly damaging 0.48
R3872:Scfd1 UTSW 12 51392196 missense probably damaging 0.98
R4080:Scfd1 UTSW 12 51431519 missense probably benign
R4356:Scfd1 UTSW 12 51439285 missense probably benign 0.00
R4841:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4842:Scfd1 UTSW 12 51389326 missense probably damaging 0.96
R4909:Scfd1 UTSW 12 51390412 missense probably benign 0.00
R5004:Scfd1 UTSW 12 51444994 missense probably benign 0.03
R5275:Scfd1 UTSW 12 51415589 missense probably benign 0.19
R5494:Scfd1 UTSW 12 51396739 splice site probably null
R5779:Scfd1 UTSW 12 51431529 missense probably benign
R6000:Scfd1 UTSW 12 51445674 missense possibly damaging 0.55
R6017:Scfd1 UTSW 12 51445678 missense probably damaging 1.00
R6522:Scfd1 UTSW 12 51431541 missense probably benign 0.04
R7748:Scfd1 UTSW 12 51389357 missense probably benign 0.21
RF007:Scfd1 UTSW 12 51422973 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCGCTGGCATTTAAATTCAGG -3'
(R):5'- AGAGGACTCCAGTCTCCAATTTTC -3'

Sequencing Primer
(F):5'- CGCTGGCATTTAAATTCAGGCTTTG -3'
(R):5'- GGACTCCAGTCTCCAATTTTCTAATG -3'
Posted On2018-11-28