Incidental Mutation 'R5779:Scfd1'
ID 446890
Institutional Source Beutler Lab
Gene Symbol Scfd1
Ensembl Gene ENSMUSG00000020952
Gene Name Sec1 family domain containing 1
Synonyms RA410, STXBP1L2, 3110021P21Rik
MMRRC Submission 043377-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R5779 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 51424296-51496887 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51478312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 508 (N508S)
Ref Sequence ENSEMBL: ENSMUSP00000021335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335]
AlphaFold Q8BRF7
Predicted Effect probably benign
Transcript: ENSMUST00000021335
AA Change: N508S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952
AA Change: N508S

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000218138
AA Change: N89S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219686
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,075,496 (GRCm39) M1332V probably benign Het
Acsbg3 A T 17: 57,188,061 (GRCm39) N190Y probably benign Het
Afg3l2 T C 18: 67,573,513 (GRCm39) K132R probably null Het
Antkmt A G 17: 26,009,631 (GRCm39) V194A probably benign Het
Arap3 T C 18: 38,117,418 (GRCm39) D886G probably damaging Het
B3gntl1 G T 11: 121,542,502 (GRCm39) probably null Het
Cdk12 T A 11: 98,109,900 (GRCm39) S640R probably benign Het
Ceacam12 C A 7: 17,803,079 (GRCm39) P162T probably benign Het
Chrna5 C A 9: 54,905,388 (GRCm39) H67N probably benign Het
Copb1 T A 7: 113,818,807 (GRCm39) D837V probably damaging Het
Dcaf5 C T 12: 80,385,606 (GRCm39) R840H probably benign Het
Ect2l T A 10: 18,039,186 (GRCm39) Q324L probably benign Het
Eef1e1 T C 13: 38,830,249 (GRCm39) N141S probably damaging Het
Eif2ak4 A C 2: 118,243,444 (GRCm39) N208T possibly damaging Het
Ext1 A G 15: 53,207,949 (GRCm39) Y271H probably damaging Het
Fbxo5 G A 10: 5,750,303 (GRCm39) R323C possibly damaging Het
Fpr-rs3 C A 17: 20,844,488 (GRCm39) A218S possibly damaging Het
Gm20499 G A 5: 114,955,082 (GRCm39) probably benign Het
Gm57859 A G 11: 113,578,818 (GRCm39) D71G probably benign Het
Gucy1b2 C A 14: 62,651,750 (GRCm39) L400F possibly damaging Het
Hgd T A 16: 37,413,733 (GRCm39) L24H probably benign Het
Hmx3 C A 7: 131,146,057 (GRCm39) S255* probably null Het
Ifrd1 A T 12: 40,253,369 (GRCm39) F448I probably damaging Het
Igfn1 T A 1: 135,894,578 (GRCm39) E1996V probably benign Het
Itpr1 G A 6: 108,329,104 (GRCm39) G173R probably damaging Het
Kbtbd8 T C 6: 95,095,515 (GRCm39) S26P probably benign Het
Kctd17 A T 15: 78,321,333 (GRCm39) probably benign Het
Matr3 T C 18: 35,717,575 (GRCm39) S258P possibly damaging Het
Mpp4 G A 1: 59,190,825 (GRCm39) A90V probably benign Het
Mrpl20 G A 4: 155,891,378 (GRCm39) R34Q probably damaging Het
Neb A T 2: 52,135,313 (GRCm39) S3266T probably damaging Het
Nipal3 A G 4: 135,179,650 (GRCm39) probably benign Het
Npas2 A T 1: 39,326,652 (GRCm39) T46S possibly damaging Het
Nsd3 G T 8: 26,172,685 (GRCm39) E815* probably null Het
Nup98 C A 7: 101,801,568 (GRCm39) V786L probably benign Het
Or4k2 A T 14: 50,424,203 (GRCm39) M157K possibly damaging Het
Pcdhb3 T C 18: 37,434,520 (GRCm39) V162A probably benign Het
Pcgf2 G A 11: 97,581,117 (GRCm39) P58L probably damaging Het
Penk A G 4: 4,134,318 (GRCm39) F110L probably damaging Het
Relch T G 1: 105,615,072 (GRCm39) N246K probably damaging Het
Scn2a T C 2: 65,594,827 (GRCm39) V1892A probably benign Het
Sema6a G A 18: 47,381,893 (GRCm39) R885C probably damaging Het
Sik2 T C 9: 50,807,145 (GRCm39) H755R probably benign Het
Slc36a3 A T 11: 55,026,094 (GRCm39) Y241* probably null Het
Smg5 T C 3: 88,258,925 (GRCm39) probably benign Het
Spag9 A G 11: 94,005,079 (GRCm39) T1049A probably benign Het
Tas2r103 T C 6: 133,013,908 (GRCm39) M53V probably benign Het
Tpr C T 1: 150,299,292 (GRCm39) A1090V probably damaging Het
Traf5 T A 1: 191,729,633 (GRCm39) R473W probably damaging Het
Ush2a T C 1: 188,175,707 (GRCm39) probably null Het
Vit A G 17: 78,853,855 (GRCm39) T34A probably benign Het
Other mutations in Scfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Scfd1 APN 12 51,474,652 (GRCm39) missense probably benign 0.01
IGL00640:Scfd1 APN 12 51,436,098 (GRCm39) missense probably benign 0.12
IGL01481:Scfd1 APN 12 51,430,903 (GRCm39) missense probably damaging 0.99
IGL01585:Scfd1 APN 12 51,462,336 (GRCm39) missense probably damaging 1.00
IGL01862:Scfd1 APN 12 51,492,494 (GRCm39) missense probably damaging 1.00
IGL02000:Scfd1 APN 12 51,460,900 (GRCm39) missense probably benign 0.03
IGL02226:Scfd1 APN 12 51,436,164 (GRCm39) splice site probably benign
IGL02327:Scfd1 APN 12 51,436,100 (GRCm39) missense possibly damaging 0.81
IGL02503:Scfd1 APN 12 51,469,704 (GRCm39) missense possibly damaging 0.90
IGL02585:Scfd1 APN 12 51,433,890 (GRCm39) missense probably damaging 0.97
IGL02732:Scfd1 APN 12 51,469,756 (GRCm39) missense probably benign 0.01
R0671:Scfd1 UTSW 12 51,459,411 (GRCm39) missense probably benign 0.01
R0707:Scfd1 UTSW 12 51,459,360 (GRCm39) missense probably damaging 0.98
R1467:Scfd1 UTSW 12 51,478,281 (GRCm39) missense possibly damaging 0.49
R1467:Scfd1 UTSW 12 51,478,281 (GRCm39) missense possibly damaging 0.49
R1962:Scfd1 UTSW 12 51,469,769 (GRCm39) missense probably benign 0.00
R2173:Scfd1 UTSW 12 51,433,862 (GRCm39) missense probably benign 0.22
R2249:Scfd1 UTSW 12 51,462,299 (GRCm39) missense possibly damaging 0.48
R3872:Scfd1 UTSW 12 51,438,979 (GRCm39) missense probably damaging 0.98
R4080:Scfd1 UTSW 12 51,478,302 (GRCm39) missense probably benign
R4356:Scfd1 UTSW 12 51,486,068 (GRCm39) missense probably benign 0.00
R4841:Scfd1 UTSW 12 51,436,109 (GRCm39) missense probably damaging 0.96
R4842:Scfd1 UTSW 12 51,436,109 (GRCm39) missense probably damaging 0.96
R4909:Scfd1 UTSW 12 51,437,195 (GRCm39) missense probably benign 0.00
R5004:Scfd1 UTSW 12 51,491,777 (GRCm39) missense probably benign 0.03
R5275:Scfd1 UTSW 12 51,462,372 (GRCm39) missense probably benign 0.19
R5494:Scfd1 UTSW 12 51,443,522 (GRCm39) splice site probably null
R6000:Scfd1 UTSW 12 51,492,457 (GRCm39) missense possibly damaging 0.55
R6017:Scfd1 UTSW 12 51,492,461 (GRCm39) missense probably damaging 1.00
R6522:Scfd1 UTSW 12 51,478,324 (GRCm39) missense probably benign 0.04
R6954:Scfd1 UTSW 12 51,474,729 (GRCm39) critical splice donor site probably null
R7748:Scfd1 UTSW 12 51,436,140 (GRCm39) missense probably benign 0.21
R7993:Scfd1 UTSW 12 51,492,490 (GRCm39) missense probably damaging 1.00
R8122:Scfd1 UTSW 12 51,480,052 (GRCm39) missense possibly damaging 0.95
R8353:Scfd1 UTSW 12 51,459,374 (GRCm39) missense possibly damaging 0.91
R8453:Scfd1 UTSW 12 51,459,374 (GRCm39) missense possibly damaging 0.91
R8890:Scfd1 UTSW 12 51,474,678 (GRCm39) missense probably benign
R9284:Scfd1 UTSW 12 51,439,024 (GRCm39) missense probably benign 0.00
R9294:Scfd1 UTSW 12 51,440,649 (GRCm39) missense possibly damaging 0.76
RF007:Scfd1 UTSW 12 51,469,756 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCACTGAGTTACCTCCAG -3'
(R):5'- GGAGAATCACAGCTATTCCAGG -3'

Sequencing Primer
(F):5'- GCTGTGCATTAGGGAATCTCAG -3'
(R):5'- CAGCTATTCCAGGAAGCCAGG -3'
Posted On 2016-12-15