Incidental Mutation 'R7938:Zw10'
ID648873
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7938 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49071633 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 521 (D521E)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect probably benign
Transcript: ENSMUST00000034803
AA Change: D521E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: D521E

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213787
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,885 K393E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bcam T G 7: 19,756,813 E586D probably benign Het
Bmp7 A C 2: 172,879,490 I264S probably benign Het
Casz1 G A 4: 148,944,486 M1129I probably benign Het
Ccdc59 T A 10: 105,841,594 N31K probably benign Het
Cfap61 A G 2: 146,045,456 Y607C probably benign Het
Cnga1 T C 5: 72,604,254 E639G probably benign Het
Coch T A 12: 51,596,583 probably null Het
Col6a6 A C 9: 105,780,684 Y776* probably null Het
Cyp1a1 T G 9: 57,701,790 L318R probably damaging Het
Cyp3a16 T A 5: 145,452,856 Y233F probably benign Het
Dgkz G T 2: 91,965,472 R42S probably damaging Het
Dner A G 1: 84,695,497 Y78H possibly damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fat2 T C 11: 55,273,096 N3111S probably damaging Het
Frmpd2 T C 14: 33,538,289 S768P probably benign Het
Gm45861 T A 8: 27,581,962 N1269K unknown Het
Gpr12 T A 5: 146,583,284 Y276F possibly damaging Het
Hace1 C T 10: 45,686,696 P769L probably benign Het
Hapln1 G A 13: 89,605,228 R171H probably damaging Het
Hlx T G 1: 184,731,928 T72P probably benign Het
Iqcm G T 8: 75,577,968 C119F probably benign Het
Katna1 G T 10: 7,761,311 A409S probably benign Het
Kcnip2 A T 19: 45,794,290 I204N probably damaging Het
Kel G T 6: 41,698,376 Q314K probably benign Het
Klf5 T C 14: 99,299,008 V5A probably damaging Het
Lax1 A T 1: 133,680,158 C282S probably benign Het
Lyar A G 5: 38,230,951 T274A probably benign Het
Mboat1 A G 13: 30,231,976 H306R possibly damaging Het
Morn5 A T 2: 36,057,070 Y120F probably benign Het
Mrgprx2 T C 7: 48,482,492 T193A probably benign Het
Myh10 T A 11: 68,692,501 W8R unknown Het
Nfasc A G 1: 132,605,531 V644A probably damaging Het
Nup153 G T 13: 46,689,379 probably null Het
Olfr1269 A T 2: 90,118,829 Y256* probably null Het
Olfr187 A T 16: 59,035,962 Y258* probably null Het
Olfr99 T A 17: 37,280,100 M107L probably benign Het
Orc4 A T 2: 48,910,191 V315E possibly damaging Het
Pcsk5 T A 19: 17,466,185 probably null Het
Pif1 A G 9: 65,594,791 D635G probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppfia2 A G 10: 106,474,787 T52A probably damaging Het
Ppp1r36 A T 12: 76,438,406 D301V probably damaging Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Qser1 A C 2: 104,788,967 V410G probably damaging Het
Reln A C 5: 21,950,872 N2207K probably damaging Het
Rimkla A G 4: 119,470,613 V180A probably benign Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rsph3a G T 17: 7,946,218 E137* probably null Het
Sqle C A 15: 59,324,466 H369Q probably damaging Het
Srebf2 T A 15: 82,172,815 D250E probably damaging Het
Svs3b A T 2: 164,255,647 C251* probably null Het
Tdrd9 A T 12: 112,031,215 N713Y possibly damaging Het
Terf2ip T C 8: 112,012,085 S202P possibly damaging Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trav8-1 T G 14: 53,470,231 D109E possibly damaging Het
Trem2 T A 17: 48,351,749 S181T probably benign Het
Trim37 A G 11: 87,147,037 N199S probably benign Het
Tshz3 T C 7: 36,769,158 F191L probably damaging Het
Ubxn8 A G 8: 33,621,684 M227T probably damaging Het
Uggt2 T A 14: 119,059,107 I448F possibly damaging Het
Usp47 T A 7: 112,087,925 L697M probably damaging Het
Vmn2r52 T C 7: 10,159,373 D613G probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Zfp423 T C 8: 87,895,676 Y11C unknown Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 splice site probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 splice site probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
R8120:Zw10 UTSW 9 49074113 missense probably benign 0.26
R8376:Zw10 UTSW 9 49077483 missense possibly damaging 0.85
RF007:Zw10 UTSW 9 49060920 missense possibly damaging 0.81
Z1177:Zw10 UTSW 9 49074096 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTTCCTGCAGTGACCAAGG -3'
(R):5'- CTGGACACAGTTCTTTTGAGCTTC -3'

Sequencing Primer
(F):5'- CAGTGACCAAGGCGTGTG -3'
(R):5'- CACAGTTCTTTTGAGCTTCTAAGTG -3'
Posted On2020-09-15