Incidental Mutation 'R7938:Rpa1'
ID 648886
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Name replication protein A1
Synonyms Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7938 (G1)
Quality Score 217.468
Status Validated
Chromosome 11
Chromosomal Location 75298166-75348324 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CA to C at 75307224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
AlphaFold Q8VEE4
Predicted Effect probably null
Transcript: ENSMUST00000000767
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092907
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,885 K393E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bcam T G 7: 19,756,813 E586D probably benign Het
Bmp7 A C 2: 172,879,490 I264S probably benign Het
Casz1 G A 4: 148,944,486 M1129I probably benign Het
Ccdc59 T A 10: 105,841,594 N31K probably benign Het
Cfap61 A G 2: 146,045,456 Y607C probably benign Het
Cnga1 T C 5: 72,604,254 E639G probably benign Het
Coch T A 12: 51,596,583 probably null Het
Col6a6 A C 9: 105,780,684 Y776* probably null Het
Cyp1a1 T G 9: 57,701,790 L318R probably damaging Het
Cyp3a16 T A 5: 145,452,856 Y233F probably benign Het
Dgkz G T 2: 91,965,472 R42S probably damaging Het
Dner A G 1: 84,695,497 Y78H possibly damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fat2 T C 11: 55,273,096 N3111S probably damaging Het
Frmpd2 T C 14: 33,538,289 S768P probably benign Het
Gm45861 T A 8: 27,581,962 N1269K unknown Het
Gpr12 T A 5: 146,583,284 Y276F possibly damaging Het
Hace1 C T 10: 45,686,696 P769L probably benign Het
Hapln1 G A 13: 89,605,228 R171H probably damaging Het
Hlx T G 1: 184,731,928 T72P probably benign Het
Iqcm G T 8: 75,577,968 C119F probably benign Het
Katna1 G T 10: 7,761,311 A409S probably benign Het
Kcnip2 A T 19: 45,794,290 I204N probably damaging Het
Kel G T 6: 41,698,376 Q314K probably benign Het
Klf5 T C 14: 99,299,008 V5A probably damaging Het
Lax1 A T 1: 133,680,158 C282S probably benign Het
Lyar A G 5: 38,230,951 T274A probably benign Het
Mboat1 A G 13: 30,231,976 H306R possibly damaging Het
Morn5 A T 2: 36,057,070 Y120F probably benign Het
Mrgprx2 T C 7: 48,482,492 T193A probably benign Het
Myh10 T A 11: 68,692,501 W8R unknown Het
Nfasc A G 1: 132,605,531 V644A probably damaging Het
Nup153 G T 13: 46,689,379 probably null Het
Olfr1269 A T 2: 90,118,829 Y256* probably null Het
Olfr187 A T 16: 59,035,962 Y258* probably null Het
Olfr99 T A 17: 37,280,100 M107L probably benign Het
Orc4 A T 2: 48,910,191 V315E possibly damaging Het
Pcsk5 T A 19: 17,466,185 probably null Het
Pif1 A G 9: 65,594,791 D635G probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppfia2 A G 10: 106,474,787 T52A probably damaging Het
Ppp1r36 A T 12: 76,438,406 D301V probably damaging Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Qser1 A C 2: 104,788,967 V410G probably damaging Het
Reln A C 5: 21,950,872 N2207K probably damaging Het
Rimkla A G 4: 119,470,613 V180A probably benign Het
Rsph3a G T 17: 7,946,218 E137* probably null Het
Sqle C A 15: 59,324,466 H369Q probably damaging Het
Srebf2 T A 15: 82,172,815 D250E probably damaging Het
Svs3b A T 2: 164,255,647 C251* probably null Het
Tdrd9 A T 12: 112,031,215 N713Y possibly damaging Het
Terf2ip T C 8: 112,012,085 S202P possibly damaging Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trav8-1 T G 14: 53,470,231 D109E possibly damaging Het
Trem2 T A 17: 48,351,749 S181T probably benign Het
Trim37 A G 11: 87,147,037 N199S probably benign Het
Tshz3 T C 7: 36,769,158 F191L probably damaging Het
Ubxn8 A G 8: 33,621,684 M227T probably damaging Het
Uggt2 T A 14: 119,059,107 I448F possibly damaging Het
Usp47 T A 7: 112,087,925 L697M probably damaging Het
Vmn2r52 T C 7: 10,159,373 D613G probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Zfp423 T C 8: 87,895,676 Y11C unknown Het
Zw10 T A 9: 49,071,633 D521E probably benign Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
nonnae UTSW 11 75314895 missense probably damaging 1.00
R6762_Rpa1_753 UTSW 11 75340345 missense possibly damaging 0.89
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7890:Rpa1 UTSW 11 75307224 frame shift probably null
R8116:Rpa1 UTSW 11 75302675 missense possibly damaging 0.90
R8258:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8259:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8837:Rpa1 UTSW 11 75313341 missense possibly damaging 0.70
R9169:Rpa1 UTSW 11 75310173 nonsense probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCCCAGGCCTATCTGATTTC -3'
(R):5'- TTCTGCATATCGCTCGTGAG -3'

Sequencing Primer
(F):5'- GATTTCCTCAGCACACCCC -3'
(R):5'- GCGTGGGAGCTAGGATGTACAC -3'
Posted On 2020-09-15