Incidental Mutation 'R5637:Zw10'
ID440450
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49057650 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect probably damaging
Transcript: ENSMUST00000034803
AA Change: V38A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: V38A

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215706
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 splice site probably null
PIT4382001:Zw10 UTSW 9 49071644 missense probably benign 0.15
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5983:Zw10 UTSW 9 49077445 splice site probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
R7938:Zw10 UTSW 9 49071633 missense probably benign 0.04
R8120:Zw10 UTSW 9 49074113 missense probably benign 0.26
R8376:Zw10 UTSW 9 49077483 missense possibly damaging 0.85
RF007:Zw10 UTSW 9 49060920 missense possibly damaging 0.81
Z1177:Zw10 UTSW 9 49074096 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAGATCTTGCCCATCCTTGG -3'
(R):5'- GTTTCACAGGATAGCCTTGGAAAAC -3'

Sequencing Primer
(F):5'- CCATCCTTGGGGGTTGGG -3'
(R):5'- GAGGTTATTAATATGATGCCTCCCC -3'
Posted On2016-11-08