Incidental Mutation 'R7956:Olfr706'
ID649828
Institutional Source Beutler Lab
Gene Symbol Olfr706
Ensembl Gene ENSMUSG00000109354
Gene Nameolfactory receptor 706
SynonymsGA_x6K02T2PBJ9-9271198-9270248, MOR283-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R7956 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106882589-106888162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106885971 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 282 (T282I)
Ref Sequence ENSEMBL: ENSMUSP00000150075 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209025
AA Change: T282I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect possibly damaging
Transcript: ENSMUST00000213918
AA Change: T282I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,950,762 S332G possibly damaging Het
Acaca A T 11: 84,320,580 N1573Y probably damaging Het
Arhgef33 A G 17: 80,355,048 K220R possibly damaging Het
Arsj A T 3: 126,438,502 D299V probably damaging Het
Asic3 A C 5: 24,416,977 I412L possibly damaging Het
AU018091 A T 7: 3,161,255 L278Q probably benign Het
Baat A T 4: 49,490,117 F322L probably damaging Het
Bap1 A G 14: 31,255,568 Q280R probably benign Het
Bet1 T C 6: 4,079,965 E66G probably benign Het
Brpf1 T C 6: 113,320,532 S1000P probably benign Het
Ccdc78 A T 17: 25,787,117 E86D possibly damaging Het
Ccdc88a T G 11: 29,463,892 L810R probably damaging Het
Cd209f T C 8: 4,104,859 T80A probably benign Het
Chrna7 T G 7: 63,103,793 K326T possibly damaging Het
Cldn15 T C 5: 136,974,650 S169P probably damaging Het
Corin A G 5: 72,422,187 S281P probably damaging Het
Coro1a A G 7: 126,701,555 V200A probably benign Het
Crebrf C G 17: 26,742,657 P243A probably benign Het
Cxxc1 T G 18: 74,218,983 probably null Het
D10Jhu81e T C 10: 78,163,571 probably null Het
Dera C T 6: 137,836,828 T282M probably benign Het
Dnah12 A T 14: 26,709,272 D345V probably damaging Het
Dopey2 T C 16: 93,771,028 probably null Het
Dscr3 T C 16: 94,501,646 N234D probably damaging Het
Dst T A 1: 34,225,618 V2623E probably damaging Het
Dysf T C 6: 84,008,996 F28L probably benign Het
Eogt C A 6: 97,143,965 V96F probably benign Het
Exoc1 A T 5: 76,557,857 T464S probably benign Het
Fam234a A G 17: 26,216,577 Y278H probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gne T A 4: 44,044,962 I391L probably benign Het
Gpr1 T C 1: 63,183,506 N190S probably damaging Het
Gpr22 G T 12: 31,709,220 T301K possibly damaging Het
Gria1 A G 11: 57,189,800 D203G possibly damaging Het
Grin2c T C 11: 115,250,148 E1048G probably benign Het
Hcn4 A G 9: 58,844,173 T361A unknown Het
Herc2 T C 7: 56,113,400 S918P probably damaging Het
Hr A G 14: 70,559,887 E520G probably benign Het
Idi1 T G 13: 8,887,960 S147R possibly damaging Het
Irf9 G A 14: 55,609,024 G464E probably benign Het
Kif16b T C 2: 142,862,470 Y63C probably benign Het
Klhl31 A T 9: 77,650,621 E206D probably benign Het
Lrch3 A G 16: 32,986,007 M454V probably null Het
Lrp1b A C 2: 41,282,149 probably null Het
Lyst A G 13: 13,641,203 D1224G possibly damaging Het
Maf1 T A 15: 76,352,496 F9L probably benign Het
Mllt10 T A 2: 18,170,257 I542N probably benign Het
Mrpl19 T C 6: 81,963,981 N143S probably benign Het
Myo5c A G 9: 75,252,563 N291S probably benign Het
Myocd G T 11: 65,269,668 L11M possibly damaging Het
Olfr1436 A C 19: 12,298,302 F277V probably damaging Het
Olfr202 C A 16: 59,284,493 M1I probably null Het
Otogl T C 10: 107,878,026 I511V possibly damaging Het
Phf19 T C 2: 34,906,555 Y121C possibly damaging Het
Pik3c2a T C 7: 116,350,115 T1346A probably benign Het
Polr2b A G 5: 77,320,245 T131A probably benign Het
Pom121 T C 5: 135,383,961 T456A unknown Het
Pom121l2 T C 13: 21,983,146 L529S probably damaging Het
Prss34 A G 17: 25,299,579 I214V probably benign Het
Prss42 A G 9: 110,799,334 Y182C probably damaging Het
Rapgef1 A G 2: 29,699,015 I223V probably benign Het
Rbbp6 C T 7: 123,001,338 P1523S unknown Het
Ripk1 T G 13: 34,009,683 N9K probably benign Het
Six4 A G 12: 73,103,761 L670S possibly damaging Het
Skint6 C T 4: 112,846,697 D994N possibly damaging Het
Slc18a1 T C 8: 69,038,814 D516G probably benign Het
Slc35g3 A T 11: 69,760,797 Y121N probably damaging Het
Slc41a1 T G 1: 131,844,028 S393R possibly damaging Het
Smg7 T C 1: 152,844,202 H818R probably benign Het
Sorl1 A G 9: 41,989,359 Y1686H probably damaging Het
Stab1 G T 14: 31,160,024 T521K probably benign Het
Stard9 T A 2: 120,705,371 Y4036* probably null Het
Tek T G 4: 94,799,343 probably null Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tgm1 T A 14: 55,708,895 H428L probably benign Het
Tigd3 G A 19: 5,892,566 P179S possibly damaging Het
Tnip3 T A 6: 65,614,795 probably null Het
Ttc1 A G 11: 43,736,413 probably null Het
Utp20 C T 10: 88,782,614 E1175K probably benign Het
Vmn1r151 A T 7: 22,499,660 S7T possibly damaging Het
Vmn1r34 T A 6: 66,637,793 probably benign Het
Vmn2r74 A T 7: 85,955,958 M494K probably benign Het
Vsig10l T C 7: 43,468,070 S594P probably benign Het
Zfp937 A G 2: 150,239,156 S369G probably benign Het
Other mutations in Olfr706
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02311:Olfr706 APN 7 106885894 missense probably benign 0.00
IGL03093:Olfr706 APN 7 106886203 missense probably benign 0.02
IGL03354:Olfr706 APN 7 106886100 missense probably benign 0.07
R0334:Olfr706 UTSW 7 106886415 missense probably benign 0.00
R1577:Olfr706 UTSW 7 106886010 missense probably benign 0.03
R4083:Olfr706 UTSW 7 106886644 missense probably damaging 0.97
R4399:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R4421:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R5202:Olfr706 UTSW 7 106886596 missense possibly damaging 0.90
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6375:Olfr706 UTSW 7 106886014 missense probably benign
R6475:Olfr706 UTSW 7 106886397 missense probably benign 0.00
R7665:Olfr706 UTSW 7 106886673 missense possibly damaging 0.95
R7742:Olfr706 UTSW 7 106886622 missense probably damaging 1.00
Z1088:Olfr706 UTSW 7 106886296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTATGTCTACCTTGGTAATTCATCCAG -3'
(R):5'- ACTGTGCTGCACATGCCTTC -3'

Sequencing Primer
(F):5'- ATTCATCCAGATACTTTCCAATCAC -3'
(R):5'- GTGCTGCACATGCCTTCAAATG -3'
Posted On2020-09-15