Incidental Mutation 'R7978:Aasdh'
ID651021
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76888668 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 342 (I342N)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: I342N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: I342N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: I342N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: I342N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126741
AA Change: I342N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: I342N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146570
AA Change: I342N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: I342N

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alb A T 5: 90,472,073 N453I possibly damaging Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Ap1g1 C T 8: 109,837,767 R315* probably null Het
Cachd1 T C 4: 100,974,863 Y741H probably damaging Het
Cacna2d2 C G 9: 107,518,257 L661V probably benign Het
Ccdc90b T A 7: 92,567,713 H64Q probably damaging Het
Ccdc93 C A 1: 121,499,231 N582K possibly damaging Het
Cdh7 A G 1: 109,994,105 probably benign Het
Cnksr1 T C 4: 134,236,031 N78D probably damaging Het
Cttnbp2nl A G 3: 105,007,991 V132A probably damaging Het
Cwc25 G A 11: 97,753,218 Q230* probably null Het
Dsel G A 1: 111,859,719 R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Fam120a T C 13: 48,902,274 Y646C probably damaging Het
Hltf T C 3: 20,092,804 W576R probably damaging Het
Hmcn2 A G 2: 31,389,347 N1787S probably benign Het
Ift122 A G 6: 115,920,352 E904G probably benign Het
Igkv17-121 C T 6: 68,036,822 T2I unknown Het
Ino80 T G 2: 119,439,393 R590S possibly damaging Het
Intu T A 3: 40,697,639 I842N probably damaging Het
Itgae A T 11: 73,134,087 T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna10 A G 3: 107,194,347 E98G probably damaging Het
Kcnb2 T A 1: 15,710,613 Y570N probably benign Het
Kmt2c T C 5: 25,359,678 I923V probably benign Het
Kptn A G 7: 16,125,772 D307G probably damaging Het
Myo3b T C 2: 70,253,114 Y704H probably damaging Het
Olfr103 A G 17: 37,336,501 F244L probably benign Het
Olfr1186 T A 2: 88,525,670 L29* probably null Het
Olfr1312 T C 2: 112,042,178 T285A possibly damaging Het
Olfr48 A T 2: 89,844,267 C235* probably null Het
Pmel G A 10: 128,715,950 V218M probably damaging Het
Prkar2b T C 12: 31,963,025 H364R possibly damaging Het
Psd4 T C 2: 24,404,855 F809S probably damaging Het
Rabgap1l A G 1: 160,251,268 S59P Het
Rgr A G 14: 37,044,688 F134L probably benign Het
Rspry1 G T 8: 94,623,125 R47L probably damaging Het
Scd3 G T 19: 44,234,249 E113* probably null Het
Slc22a12 G A 19: 6,536,908 A476V possibly damaging Het
Smg1 T C 7: 118,193,655 E560G unknown Het
Snx3 A G 10: 42,502,350 D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d12 A G 19: 38,916,841 M667V probably benign Het
Tbc1d30 A T 10: 121,306,199 V81E probably damaging Het
Tbc1d9 A T 8: 83,239,954 I395F probably damaging Het
Tes C A 6: 17,096,323 N103K probably benign Het
Tet2 T C 3: 133,487,665 Y336C possibly damaging Het
Tgfbr3 T C 5: 107,139,860 N491S probably damaging Het
Tomt T C 7: 101,900,347 I245V probably damaging Het
Trbc1 T C 6: 41,538,302 L28P Het
Trp63 T C 16: 25,820,686 V208A unknown Het
Ttll8 G T 15: 88,915,362 N625K probably benign Het
Ush2a T A 1: 188,399,938 W786R probably benign Het
Vmn2r97 A T 17: 18,947,592 I703F probably damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8425:Aasdh UTSW 5 76886277 missense possibly damaging 0.49
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAAGAGTGTGCTTCCTAC -3'
(R):5'- CAACGCCAACATTGCTGAG -3'

Sequencing Primer
(F):5'- TACGCAAGGACATGACTTGTAC -3'
(R):5'- CGCCAACATTGCTGAGAAGATTTG -3'
Posted On2020-09-15