Incidental Mutation 'R7990:Zfp971'
ID651669
Institutional Source Beutler Lab
Gene Symbol Zfp971
Ensembl Gene ENSMUSG00000074519
Gene Namezinc finger protein 971
SynonymsEtohi1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7990 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location178023284-178034022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 178033568 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 320 (T320I)
Ref Sequence ENSEMBL: ENSMUSP00000104554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108925] [ENSMUST00000108926]
Predicted Effect probably benign
Transcript: ENSMUST00000108925
SMART Domains Protein: ENSMUSP00000104553
Gene: ENSMUSG00000074519

DomainStartEndE-ValueType
KRAB 4 64 1.2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108926
AA Change: T320I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104554
Gene: ENSMUSG00000074519
AA Change: T320I

DomainStartEndE-ValueType
KRAB 4 66 1.6e-13 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 125 4.38e1 SMART
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 4.79e-3 SMART
ZnF_C2H2 187 209 2.36e-2 SMART
ZnF_C2H2 215 237 2.36e-2 SMART
ZnF_C2H2 243 265 3.69e-4 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 4.4e-2 SMART
ZnF_C2H2 327 349 4.61e-5 SMART
ZnF_C2H2 355 377 4.94e-5 SMART
ZnF_C2H2 383 405 3.21e-4 SMART
ZnF_C2H2 411 433 4.47e-3 SMART
ZnF_C2H2 439 461 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik T C 6: 73,469,545 Y7C probably damaging Het
4933434E20Rik G A 3: 90,063,242 V28I probably damaging Het
Abcd4 G T 12: 84,604,388 probably null Het
Alg2 T C 4: 47,472,308 T167A probably damaging Het
Asap1 T C 15: 64,172,737 probably null Het
Atad5 T A 11: 80,133,253 C1730* probably null Het
Atp8b1 T C 18: 64,538,677 T1092A possibly damaging Het
C130050O18Rik A G 5: 139,414,917 T242A probably benign Het
Ccdc88c A G 12: 100,967,985 V211A probably damaging Het
Ccnl1 A G 3: 65,946,893 S436P possibly damaging Het
Cgnl1 T C 9: 71,725,265 E268G probably damaging Het
Clca4b T G 3: 144,928,342 D104A probably damaging Het
Col6a3 T G 1: 90,781,855 K2480T unknown Het
Cryba1 T C 11: 77,723,585 T21A possibly damaging Het
Csn1s1 C T 5: 87,680,053 A259V possibly damaging Het
Dap3 A C 3: 88,928,507 Y206* probably null Het
Etnppl T C 3: 130,630,659 I360T possibly damaging Het
Gal3st3 A T 19: 5,302,589 M15L probably benign Het
Gdf5 A G 2: 155,941,829 V401A probably damaging Het
Gm1110 A G 9: 26,880,841 S628P possibly damaging Het
Gm9493 A T 19: 23,620,033 I98F possibly damaging Het
Grin2a T C 16: 9,579,176 K1016E possibly damaging Het
Hdac9 T C 12: 34,215,453 N850D probably benign Het
Itsn2 C A 12: 4,635,629 L466I unknown Het
Kcnj16 C A 11: 111,025,060 R183S probably damaging Het
Kcnk2 A C 1: 189,209,905 L389R probably damaging Het
Kdm4c A C 4: 74,391,448 K949N probably damaging Het
Kif3b G A 2: 153,317,463 E395K probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Map3k1 A T 13: 111,756,162 M853K probably benign Het
Metap1 T G 3: 138,480,765 T68P probably benign Het
Mfsd11 T C 11: 116,859,497 V114A possibly damaging Het
Mroh1 G A 15: 76,452,275 R1566H probably damaging Het
Msh4 A T 3: 153,896,892 M233K probably damaging Het
Ncor1 T G 11: 62,349,495 probably null Het
Npl A T 1: 153,537,484 V29D possibly damaging Het
Olfr389 C T 11: 73,776,671 V219I probably benign Het
Osmr T C 15: 6,852,467 I65M possibly damaging Het
Rabepk C T 2: 34,780,708 V247I probably benign Het
Rere C T 4: 150,614,870 P804S unknown Het
Rpgrip1 A T 14: 52,129,518 Y265F possibly damaging Het
Slc10a1 T C 12: 80,953,780 D315G probably benign Het
Smc5 A T 19: 23,235,882 N555K probably benign Het
Spata17 T A 1: 187,140,395 H26L unknown Het
Sphkap C T 1: 83,267,345 D1518N probably damaging Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Tmx2 A G 2: 84,676,136 F71L probably damaging Het
Ush2a T A 1: 188,542,799 L1823Q probably benign Het
Virma T A 4: 11,513,983 D612E probably benign Het
Wdfy4 A T 14: 33,097,795 L1484Q Het
Zan A G 5: 137,393,090 S4711P unknown Het
Zdhhc1 A G 8: 105,476,369 probably null Het
Other mutations in Zfp971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Zfp971 APN 2 178023382 critical splice donor site probably null
R1108:Zfp971 UTSW 2 178033670 missense probably damaging 1.00
R1759:Zfp971 UTSW 2 178033929 missense probably damaging 0.99
R2183:Zfp971 UTSW 2 178033740 missense probably damaging 1.00
R2343:Zfp971 UTSW 2 178032994 missense possibly damaging 0.84
R4873:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R4875:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R5263:Zfp971 UTSW 2 178033762 missense probably damaging 1.00
R5396:Zfp971 UTSW 2 178033733 missense probably damaging 1.00
R6150:Zfp971 UTSW 2 178033454 missense probably benign 0.26
R6693:Zfp971 UTSW 2 178033431 missense probably benign 0.01
R6811:Zfp971 UTSW 2 178033881 missense possibly damaging 0.62
R7427:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7428:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7594:Zfp971 UTSW 2 178034000 missense possibly damaging 0.47
R7790:Zfp971 UTSW 2 178033499 missense probably damaging 0.96
R7796:Zfp971 UTSW 2 178031610 missense probably benign 0.00
R7934:Zfp971 UTSW 2 178033380 missense probably benign
R8671:Zfp971 UTSW 2 178033937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTCGGAATCCATAAGCGAA -3'
(R):5'- CTTTGGAGAGTACTGCTTTCTGC -3'

Sequencing Primer
(F):5'- GCAGTAAGCAGTCATCTCGGAATC -3'
(R):5'- CTGCAAAGGCTTTACCACATTG -3'
Posted On2020-09-15