Incidental Mutation 'R7950:Arl6'
ID656408
Institutional Source Beutler Lab
Gene Symbol Arl6
Ensembl Gene ENSMUSG00000022722
Gene NameADP-ribosylation factor-like 6
Synonyms1110018H24Rik, BBS3, 2210411E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R7950 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59612949-59639391 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 59618731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023405] [ENSMUST00000099646] [ENSMUST00000118438] [ENSMUST00000149797]
Predicted Effect probably benign
Transcript: ENSMUST00000023405
SMART Domains Protein: ENSMUSP00000023405
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
ARF 1 185 1.62e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099646
SMART Domains Protein: ENSMUSP00000097238
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
ARF 1 185 7.35e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118438
SMART Domains Protein: ENSMUSP00000113127
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
ARF 1 185 7.35e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149797
SMART Domains Protein: ENSMUSP00000123287
Gene: ENSMUSG00000022722

DomainStartEndE-ValueType
Pfam:Arf 4 127 6.4e-38 PFAM
Pfam:SRPRB 15 124 5.5e-10 PFAM
Pfam:Ras 19 121 2.1e-9 PFAM
Pfam:Roc 19 124 1e-12 PFAM
Pfam:Gtr1_RagA 19 125 1.2e-7 PFAM
Pfam:MMR_HSR1 19 129 2.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARF-like (ADP ribosylation factor-like) sub-family of the ARF family of GTP-binding proteins which are involved in regulation of intracellular traffic. Mutations in this gene are associated with Bardet-Biedl syndrome (BBS). A vision-specific transcript, encoding long isoform BBS3L, has been described (PMID: 20333246). [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a disorganized photoreceptor inner segment and craniofacial abnormalitries. Male mice are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Hsf1 T C 15: 76,498,193 S255P probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Arl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02390:Arl6 APN 16 59621217 splice site probably null
IGL02976:Arl6 APN 16 59623896 missense probably damaging 1.00
shrunk UTSW 16 59623894 missense probably damaging 1.00
Slunk UTSW 16 59623092 missense possibly damaging 0.54
IGL02988:Arl6 UTSW 16 59613846 critical splice acceptor site probably null
R0147:Arl6 UTSW 16 59618790 unclassified probably benign
R0390:Arl6 UTSW 16 59622421 intron probably benign
R2011:Arl6 UTSW 16 59624313 missense probably damaging 0.97
R2138:Arl6 UTSW 16 59622467 intron probably benign
R2997:Arl6 UTSW 16 59623876 critical splice donor site probably null
R4445:Arl6 UTSW 16 59624313 missense probably damaging 0.97
R4677:Arl6 UTSW 16 59618865 splice site probably null
R6004:Arl6 UTSW 16 59623894 missense probably damaging 1.00
R6251:Arl6 UTSW 16 59618806 missense probably damaging 0.99
R7171:Arl6 UTSW 16 59623092 missense possibly damaging 0.54
R7760:Arl6 UTSW 16 59618806 missense probably damaging 0.99
R7768:Arl6 UTSW 16 59632336 missense probably damaging 1.00
R8342:Arl6 UTSW 16 59622439 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGTCCCAAACTTCAGATGTG -3'
(R):5'- TCGTAGAGTTGTATGTATGACACC -3'

Sequencing Primer
(F):5'- TGTAAACACAGAAATCTGCTA -3'
(R):5'- CACCATAAAGTGAATTTTGTGTGTGG -3'
Posted On2020-11-06