Incidental Mutation 'R7950:Hsf1'
ID649519
Institutional Source Beutler Lab
Gene Symbol Hsf1
Ensembl Gene ENSMUSG00000022556
Gene Nameheat shock factor 1
Synonymsheat shock transcription factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76477422-76501913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76498193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 255 (S255P)
Ref Sequence ENSEMBL: ENSMUSP00000072617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect probably benign
Transcript: ENSMUST00000023214
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
AA Change: S255P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556
AA Change: S255P

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
AA Change: S255P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227478
AA Change: S255P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228371
AA Change: S255P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
AA Change: S255P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phsphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Aug 2016]
PHENOTYPE: Inactivation of this gene results in female infertility. Additional abnormalities observed in one line of targeted mice include placental defects, growth retardation, loss of the classical heat shock response, and impaired immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,979,767 T31I probably damaging Het
Adgrf5 G A 17: 43,451,157 V1248M probably damaging Het
Alb T C 5: 90,472,464 S478P probably damaging Het
Arhgap17 A G 7: 123,286,816 S698P probably benign Het
Arhgef5 A G 6: 43,273,925 T537A possibly damaging Het
Arl6 A T 16: 59,618,731 probably null Het
Atp13a4 A T 16: 29,449,917 W540R Het
Birc6 A T 17: 74,593,100 D1091V probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
C130074G19Rik T C 1: 184,874,374 probably null Het
C1ql4 T A 15: 99,084,812 H220L probably benign Het
Cacna1s A G 1: 136,100,625 N1147S probably benign Het
Cc2d2a T C 5: 43,695,296 probably null Het
Ccdc36 T C 9: 108,405,671 T273A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Ecel1 A T 1: 87,148,269 Y729N probably damaging Het
Epha4 T A 1: 77,507,196 I59F probably damaging Het
Filip1l A G 16: 57,569,711 K221E probably damaging Het
Flnc A G 6: 29,456,382 E2193G possibly damaging Het
Galnt10 C G 11: 57,783,723 P513A probably damaging Het
Gm5624 A G 14: 44,560,733 Y139H Het
Golgb1 A C 16: 36,915,424 I1719L probably benign Het
Ighv2-2 T C 12: 113,588,294 D108G probably damaging Het
Kbtbd3 C T 9: 4,316,878 Q10* probably null Het
Kcnh2 C T 5: 24,333,036 V110M probably benign Het
Magi3 A C 3: 104,016,689 L1112W probably damaging Het
Malrd1 T A 2: 16,128,068 D1933E unknown Het
Mki67 G A 7: 135,699,724 R1194* probably null Het
Nap1l1 T C 10: 111,492,908 Y233H probably damaging Het
Napsa A G 7: 44,585,334 I298V probably benign Het
Nkx6-1 A T 5: 101,663,599 S212R probably damaging Het
Nlrc4 A T 17: 74,445,615 I591N probably damaging Het
Olfr1468-ps1 T C 19: 13,375,067 I35T possibly damaging Het
Orc2 T C 1: 58,467,668 D503G possibly damaging Het
Osbp T A 19: 11,978,248 S343T probably benign Het
Pcdha6 T G 18: 36,969,426 D557E probably damaging Het
Pdcd11 AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 19: 47,113,437 probably benign Het
Ppdpf A G 2: 181,187,857 Y35C probably benign Het
Scrn2 T A 11: 97,030,929 L75Q probably damaging Het
Scube3 G A 17: 28,171,226 V955I probably benign Het
Slc1a1 T C 19: 28,911,761 V478A probably benign Het
Slc4a4 A G 5: 89,058,278 probably null Het
Srrm2 T C 17: 23,808,110 L96P unknown Het
Strn A T 17: 78,670,423 L175Q Het
Other mutations in Hsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Hsf1 APN 15 76498203 missense probably benign 0.01
IGL01668:Hsf1 APN 15 76496962 critical splice donor site probably null
IGL01724:Hsf1 APN 15 76496837 missense possibly damaging 0.83
IGL02111:Hsf1 APN 15 76496081 splice site probably benign
IGL02503:Hsf1 APN 15 76498670 missense probably benign 0.03
IGL03137:Hsf1 APN 15 76496449 splice site probably benign
R0350:Hsf1 UTSW 15 76500479 missense probably benign 0.00
R6906:Hsf1 UTSW 15 76477719 critical splice donor site probably null
R7170:Hsf1 UTSW 15 76500021 missense probably damaging 1.00
R7749:Hsf1 UTSW 15 76499187 missense probably benign 0.38
R8050:Hsf1 UTSW 15 76498281 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGAGTGACAGCAACTCAGCAC -3'
(R):5'- TTTCAGCTCTGCCCAAGGTC -3'

Sequencing Primer
(F):5'- AAGTATGGTCGACAGTACTCCCTG -3'
(R):5'- TCTGCCCAAGGTCATAAAGGCTG -3'
Posted On2020-09-15