Incidental Mutation 'R8732:Or14a257'
ID 662808
Institutional Source Beutler Lab
Gene Symbol Or14a257
Ensembl Gene ENSMUSG00000062878
Gene Name olfactory receptor family 14 subfamily A member 257
Synonyms GA_x6K02T2NHDJ-9619796-9620794, Olfr298, MOR219-4
MMRRC Submission 068580-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R8732 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86137759-86138757 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86138061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 233 (S233P)
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
AlphaFold Q7TS06
Predicted Effect probably damaging
Transcript: ENSMUST00000077800
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878
AA Change: S233P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213223
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216968
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217110
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.2909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,981,622 (GRCm39) N82K probably damaging Het
Ankrd36 T A 11: 5,578,906 (GRCm39) S57T possibly damaging Het
Aoc3 A G 11: 101,222,643 (GRCm39) N293S probably benign Het
Aup1 A T 6: 83,033,602 (GRCm39) H302L probably damaging Het
Bptf G A 11: 106,931,206 (GRCm39) R277W probably damaging Het
Cald1 A G 6: 34,734,946 (GRCm39) I346V unknown Het
Cd44 T C 2: 102,664,645 (GRCm39) T519A possibly damaging Het
Cela1 A G 15: 100,580,766 (GRCm39) probably null Het
Ces2g T C 8: 105,689,195 (GRCm39) V57A possibly damaging Het
Cpt1b G C 15: 89,308,628 (GRCm39) T100S probably benign Het
D6Wsu163e A T 6: 126,932,859 (GRCm39) I361F possibly damaging Het
Dock5 A T 14: 68,083,449 (GRCm39) D153E possibly damaging Het
Dync2h1 G T 9: 7,168,326 (GRCm39) R430S probably damaging Het
Dync2i2 T A 2: 29,922,220 (GRCm39) T414S possibly damaging Het
Efcab3 T A 11: 104,695,100 (GRCm39) F1730L probably benign Het
Eml5 C T 12: 98,782,218 (GRCm39) G1405R probably damaging Het
Ergic2 G A 6: 148,102,975 (GRCm39) A91V probably damaging Het
Fancl A T 11: 26,419,754 (GRCm39) I336L probably benign Het
Fpr3 A G 17: 18,191,223 (GRCm39) T165A possibly damaging Het
Gon4l A G 3: 88,807,291 (GRCm39) I1662V possibly damaging Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Hdac4 C A 1: 91,875,239 (GRCm39) A911S probably damaging Het
Ighd T C 12: 113,378,183 (GRCm39) N139D Het
Klhl22 T A 16: 17,589,690 (GRCm39) L117Q probably damaging Het
Kntc1 A G 5: 123,928,180 (GRCm39) S1226G probably benign Het
Lama5 A T 2: 179,828,481 (GRCm39) C2126S probably damaging Het
Ldlr A G 9: 21,650,985 (GRCm39) I468V probably benign Het
Lmtk3 G A 7: 45,447,712 (GRCm39) A1253T unknown Het
Lta T A 17: 35,423,045 (GRCm39) N93Y probably damaging Het
Macf1 A T 4: 123,403,563 (GRCm39) probably null Het
Mink1 A G 11: 70,500,902 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Ntpcr A G 8: 126,472,074 (GRCm39) M132V probably benign Het
Or52n1 A G 7: 104,383,115 (GRCm39) M152T probably benign Het
Or7g32 T C 9: 19,408,098 (GRCm39) I18T probably benign Het
Padi2 A G 4: 140,660,590 (GRCm39) I357V probably benign Het
Pax7 G T 4: 139,506,920 (GRCm39) H372Q probably benign Het
Paxip1 A G 5: 27,949,541 (GRCm39) Y966H probably damaging Het
Pde4b A C 4: 102,412,822 (GRCm39) D199A probably null Het
Pkd1l2 T C 8: 117,792,311 (GRCm39) N494D probably benign Het
Prdm2 G T 4: 142,862,580 (GRCm39) Q237K probably benign Het
Prune2 T C 19: 17,097,769 (GRCm39) L1091P probably damaging Het
Rab9 C T X: 165,240,754 (GRCm39) D186N probably benign Het
Rassf5 A G 1: 131,106,264 (GRCm39) *414Q probably null Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rrp9 C A 9: 106,360,388 (GRCm39) T238K probably benign Het
Slc44a2 A G 9: 21,259,882 (GRCm39) D630G probably benign Het
Slc7a9 A G 7: 35,156,443 (GRCm39) D295G probably benign Het
Slco3a1 A T 7: 73,934,054 (GRCm39) M706K possibly damaging Het
Spag9 T C 11: 93,962,514 (GRCm39) probably null Het
Stam2 A T 2: 52,590,180 (GRCm39) Y394N probably damaging Het
Stard9 T C 2: 120,510,442 (GRCm39) L341P probably damaging Het
Steap3 A T 1: 120,171,624 (GRCm39) H160Q probably damaging Het
Stxbp5l A T 16: 37,061,809 (GRCm39) C334S probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem74 A T 15: 43,731,456 (GRCm39) probably benign Het
Ttn T C 2: 76,537,480 (GRCm39) K34816R possibly damaging Het
Ttn T A 2: 76,627,735 (GRCm39) N14736I probably damaging Het
Vmn1r183 A G 7: 23,754,890 (GRCm39) Q231R possibly damaging Het
Vmn1r235 A G 17: 21,482,439 (GRCm39) T255A probably damaging Het
Wasl A T 6: 24,619,209 (GRCm39) I437K unknown Het
Ywhae A G 11: 75,642,769 (GRCm39) N43D probably damaging Het
Zfp583 A T 7: 6,320,210 (GRCm39) Y267* probably null Het
Zfp608 C T 18: 55,121,072 (GRCm39) G172R probably benign Het
Other mutations in Or14a257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Or14a257 APN 7 86,138,765 (GRCm39) utr 5 prime probably benign
IGL01603:Or14a257 APN 7 86,138,139 (GRCm39) missense possibly damaging 0.92
IGL02389:Or14a257 APN 7 86,138,336 (GRCm39) missense probably damaging 0.98
IGL03146:Or14a257 APN 7 86,138,402 (GRCm39) missense probably damaging 1.00
R0680:Or14a257 UTSW 7 86,138,545 (GRCm39) missense probably benign
R0834:Or14a257 UTSW 7 86,138,698 (GRCm39) missense probably benign 0.11
R1132:Or14a257 UTSW 7 86,138,425 (GRCm39) missense probably benign 0.03
R1519:Or14a257 UTSW 7 86,138,333 (GRCm39) missense probably damaging 0.99
R1881:Or14a257 UTSW 7 86,138,646 (GRCm39) missense probably benign 0.01
R2170:Or14a257 UTSW 7 86,137,778 (GRCm39) missense probably benign 0.03
R4500:Or14a257 UTSW 7 86,138,127 (GRCm39) missense probably benign 0.00
R4524:Or14a257 UTSW 7 86,138,034 (GRCm39) missense probably damaging 1.00
R5184:Or14a257 UTSW 7 86,138,499 (GRCm39) frame shift probably null
R5521:Or14a257 UTSW 7 86,137,839 (GRCm39) missense probably benign 0.08
R7448:Or14a257 UTSW 7 86,138,417 (GRCm39) missense probably damaging 1.00
R7643:Or14a257 UTSW 7 86,138,776 (GRCm39) critical splice acceptor site probably null
R7688:Or14a257 UTSW 7 86,138,183 (GRCm39) missense probably benign 0.01
R8104:Or14a257 UTSW 7 86,138,231 (GRCm39) missense probably damaging 1.00
R8973:Or14a257 UTSW 7 86,138,487 (GRCm39) missense probably damaging 1.00
R9235:Or14a257 UTSW 7 86,138,306 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAAAGCACGCTTGACATCAC -3'
(R):5'- TCTGTGGCTCCATTGTGATC -3'

Sequencing Primer
(F):5'- AAGCACGCTTGACATCACTATTTC -3'
(R):5'- TAAGGATCTCCTGCTCTG -3'
Posted On 2021-03-08