Incidental Mutation 'R8732:Olfr298'
ID 662808
Institutional Source Beutler Lab
Gene Symbol Olfr298
Ensembl Gene ENSMUSG00000062878
Gene Name olfactory receptor 298
Synonyms GA_x6K02T2NHDJ-9619796-9620794, MOR219-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8732 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86486322-86492484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86488853 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 233 (S233P)
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
AlphaFold Q7TS06
Predicted Effect probably damaging
Transcript: ENSMUST00000077800
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878
AA Change: S233P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213223
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216968
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217110
AA Change: S233P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.2909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp A T 13: 41,828,146 N82K probably damaging Het
Ankrd36 T A 11: 5,628,906 S57T possibly damaging Het
Aoc3 A G 11: 101,331,817 N293S probably benign Het
Aup1 A T 6: 83,056,621 H302L probably damaging Het
Bptf G A 11: 107,040,380 R277W probably damaging Het
Cald1 A G 6: 34,758,011 I346V unknown Het
Cd44 T C 2: 102,834,300 T519A possibly damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Ces2g T C 8: 104,962,563 V57A possibly damaging Het
Cpt1b G C 15: 89,424,425 T100S probably benign Het
D6Wsu163e A T 6: 126,955,896 I361F possibly damaging Het
Dock5 A T 14: 67,846,000 D153E possibly damaging Het
Dync2h1 G T 9: 7,168,326 R430S probably damaging Het
Eml5 C T 12: 98,815,959 G1405R probably damaging Het
Ergic2 G A 6: 148,201,477 A91V probably damaging Het
Fancl A T 11: 26,469,754 I336L probably benign Het
Fpr3 A G 17: 17,970,961 T165A possibly damaging Het
Gm11639 T A 11: 104,804,274 F1730L probably benign Het
Gon4l A G 3: 88,899,984 I1662V possibly damaging Het
Gpr153 C T 4: 152,279,101 probably benign Het
Hdac4 C A 1: 91,947,517 A911S probably damaging Het
Ighd T C 12: 113,414,563 N139D Het
Klhl22 T A 16: 17,771,826 L117Q probably damaging Het
Kntc1 A G 5: 123,790,117 S1226G probably benign Het
Lama5 A T 2: 180,186,688 C2126S probably damaging Het
Ldlr A G 9: 21,739,689 I468V probably benign Het
Lmtk3 G A 7: 45,798,288 A1253T unknown Het
Lta T A 17: 35,204,069 N93Y probably damaging Het
Macf1 A T 4: 123,509,770 probably null Het
Mink1 A G 11: 70,610,076 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ntpcr A G 8: 125,745,335 M132V probably benign Het
Olfr664 A G 7: 104,733,908 M152T probably benign Het
Olfr851 T C 9: 19,496,802 I18T probably benign Het
Padi2 A G 4: 140,933,279 I357V probably benign Het
Pax7 G T 4: 139,779,609 H372Q probably benign Het
Paxip1 A G 5: 27,744,543 Y966H probably damaging Het
Pde4b A C 4: 102,555,625 D199A probably null Het
Pkd1l2 T C 8: 117,065,572 N494D probably benign Het
Prdm2 G T 4: 143,136,010 Q237K probably benign Het
Prune2 T C 19: 17,120,405 L1091P probably damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Rassf5 A G 1: 131,178,527 *414Q probably null Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rrp9 C A 9: 106,483,189 T238K probably benign Het
Slc44a2 A G 9: 21,348,586 D630G probably benign Het
Slc7a9 A G 7: 35,457,018 D295G probably benign Het
Slco3a1 A T 7: 74,284,306 M706K possibly damaging Het
Spag9 T C 11: 94,071,688 probably null Het
Stam2 A T 2: 52,700,168 Y394N probably damaging Het
Stard9 T C 2: 120,679,961 L341P probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Stxbp5l A T 16: 37,241,447 C334S probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem74 A T 15: 43,868,060 probably benign Het
Ttn T C 2: 76,707,136 K34816R possibly damaging Het
Ttn T A 2: 76,797,391 N14736I probably damaging Het
Vmn1r183 A G 7: 24,055,465 Q231R possibly damaging Het
Vmn1r235 A G 17: 21,262,177 T255A probably damaging Het
Wasl A T 6: 24,619,210 I437K unknown Het
Wdr34 T A 2: 30,032,208 T414S possibly damaging Het
Ywhae A G 11: 75,751,943 N43D probably damaging Het
Zfp583 A T 7: 6,317,211 Y267* probably null Het
Zfp608 C T 18: 54,988,000 G172R probably benign Het
Other mutations in Olfr298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr298 APN 7 86489557 utr 5 prime probably benign
IGL01603:Olfr298 APN 7 86488931 missense possibly damaging 0.92
IGL02389:Olfr298 APN 7 86489128 missense probably damaging 0.98
IGL03146:Olfr298 APN 7 86489194 missense probably damaging 1.00
R0680:Olfr298 UTSW 7 86489337 missense probably benign
R0834:Olfr298 UTSW 7 86489490 missense probably benign 0.11
R1132:Olfr298 UTSW 7 86489217 missense probably benign 0.03
R1519:Olfr298 UTSW 7 86489125 missense probably damaging 0.99
R1881:Olfr298 UTSW 7 86489438 missense probably benign 0.01
R2170:Olfr298 UTSW 7 86488570 missense probably benign 0.03
R4500:Olfr298 UTSW 7 86488919 missense probably benign 0.00
R4524:Olfr298 UTSW 7 86488826 missense probably damaging 1.00
R5184:Olfr298 UTSW 7 86489291 frame shift probably null
R5521:Olfr298 UTSW 7 86488631 missense probably benign 0.08
R7448:Olfr298 UTSW 7 86489209 missense probably damaging 1.00
R7643:Olfr298 UTSW 7 86489568 critical splice acceptor site probably null
R7688:Olfr298 UTSW 7 86488975 missense probably benign 0.01
R8104:Olfr298 UTSW 7 86489023 missense probably damaging 1.00
R8973:Olfr298 UTSW 7 86489279 missense probably damaging 1.00
R9235:Olfr298 UTSW 7 86489098 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAAAGCACGCTTGACATCAC -3'
(R):5'- TCTGTGGCTCCATTGTGATC -3'

Sequencing Primer
(F):5'- AAGCACGCTTGACATCACTATTTC -3'
(R):5'- TAAGGATCTCCTGCTCTG -3'
Posted On 2021-03-08