Incidental Mutation 'R5184:Olfr298'
ID397753
Institutional Source Beutler Lab
Gene Symbol Olfr298
Ensembl Gene ENSMUSG00000062878
Gene Nameolfactory receptor 298
SynonymsGA_x6K02T2NHDJ-9619796-9620794, MOR219-4
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5184 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location86486322-86492484 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to T at 86489291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
Predicted Effect probably null
Transcript: ENSMUST00000077800
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213223
Predicted Effect probably null
Transcript: ENSMUST00000216968
Predicted Effect probably null
Transcript: ENSMUST00000217110
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prr12 C A 7: 45,046,377 V1222L unknown Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Olfr298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr298 APN 7 86489557 utr 5 prime probably benign
IGL01603:Olfr298 APN 7 86488931 missense possibly damaging 0.92
IGL02389:Olfr298 APN 7 86489128 missense probably damaging 0.98
IGL03146:Olfr298 APN 7 86489194 missense probably damaging 1.00
R0680:Olfr298 UTSW 7 86489337 missense probably benign
R0834:Olfr298 UTSW 7 86489490 missense probably benign 0.11
R1132:Olfr298 UTSW 7 86489217 missense probably benign 0.03
R1519:Olfr298 UTSW 7 86489125 missense probably damaging 0.99
R1881:Olfr298 UTSW 7 86489438 missense probably benign 0.01
R2170:Olfr298 UTSW 7 86488570 missense probably benign 0.03
R4500:Olfr298 UTSW 7 86488919 missense probably benign 0.00
R4524:Olfr298 UTSW 7 86488826 missense probably damaging 1.00
R5521:Olfr298 UTSW 7 86488631 missense probably benign 0.08
R7448:Olfr298 UTSW 7 86489209 missense probably damaging 1.00
R7643:Olfr298 UTSW 7 86489568 critical splice acceptor site probably null
R7688:Olfr298 UTSW 7 86488975 missense probably benign 0.01
R8104:Olfr298 UTSW 7 86489023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGCTGTGTATAAAGCTC -3'
(R):5'- ACAGACTGTATGTGGGCTGTTC -3'

Sequencing Primer
(F):5'- GCCAGCTGTGTATAAAGCTCCAAAG -3'
(R):5'- CTTTCTGGTAATGTACGTTGCAGTC -3'
Posted On2016-07-06