Incidental Mutation 'R8799:Suclg1'
ID671433
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8799 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73271108 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 271 (K271E)
Ref Sequence ENSEMBL: ENSMUSP00000065113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000203632]
Predicted Effect probably benign
Transcript: ENSMUST00000064740
AA Change: K271E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: K271E

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203632
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,752 C134S probably damaging Het
Acox3 T G 5: 35,589,708 F156L probably damaging Het
Adprhl1 T C 8: 13,222,474 E1428G probably benign Het
Arhgap40 A T 2: 158,512,838 M15L probably benign Het
Bahcc1 C A 11: 120,286,347 F2020L probably damaging Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Ccdc40 C A 11: 119,264,466 S1177R probably benign Het
Ccne2 A T 4: 11,201,355 R294S probably benign Het
Cib1 A C 7: 80,232,543 S6R probably damaging Het
Csnk2a1 A G 2: 152,257,966 E114G probably damaging Het
Cxxc1 A G 18: 74,221,057 probably benign Het
Decr2 A C 17: 26,088,937 I47M possibly damaging Het
Dmxl2 A G 9: 54,419,743 probably null Het
Dse G A 10: 34,184,153 probably benign Het
Eml6 A G 11: 29,758,981 V1480A probably benign Het
Erap1 A G 13: 74,657,636 I165M probably benign Het
Fan1 G T 7: 64,366,658 Q573K probably damaging Het
Fndc3a G A 14: 72,556,515 T906I probably benign Het
Gm21915 A C 9: 40,670,710 H33P possibly damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Lama3 G T 18: 12,490,943 Q1384H probably damaging Het
Lrrc34 C T 3: 30,624,830 E373K probably benign Het
Ly75 A G 2: 60,348,441 F677L probably damaging Het
Megf11 A G 9: 64,681,391 D493G probably benign Het
Mta3 A T 17: 83,788,940 I348F possibly damaging Het
Myo1d A T 11: 80,684,379 F170L probably damaging Het
Nfkbia A G 12: 55,492,298 probably benign Het
Nfx1 A T 4: 41,023,727 E1045D probably damaging Het
Npffr2 T G 5: 89,583,318 V369G probably benign Het
Olfr1136 G T 2: 87,693,713 H56Q possibly damaging Het
Olfr1312 A T 2: 112,042,183 I283N probably damaging Het
Olfr141 A T 2: 86,806,231 M256K probably damaging Het
Olfr301 T C 7: 86,412,646 C95R probably damaging Het
Olfr984 A T 9: 40,100,689 M267K possibly damaging Het
Otoa G A 7: 121,092,671 E41K possibly damaging Het
Podxl A G 6: 31,524,465 V385A probably damaging Het
Ppp4r4 C T 12: 103,601,364 T673M possibly damaging Het
Rbm20 G T 19: 53,832,689 C525F probably damaging Het
Rnf17 A T 14: 56,500,429 E1222D probably damaging Het
Ros1 G A 10: 52,046,047 A2331V probably benign Het
Rrs1 T A 1: 9,545,594 I24N probably damaging Het
Sec11a A G 7: 80,935,102 V29A possibly damaging Het
Shisa3 T A 5: 67,611,406 Y216* probably null Het
Slc22a2 A T 17: 12,612,538 Y405F probably benign Het
Slc2a12 A T 10: 22,692,206 M511L possibly damaging Het
Slc38a9 T A 13: 112,703,602 H338Q probably damaging Het
Slco1c1 T G 6: 141,559,805 S486A probably benign Het
Slit2 T C 5: 48,304,182 S1524P possibly damaging Het
Spata31d1c T C 13: 65,036,326 S561P possibly damaging Het
Stac3 T A 10: 127,504,912 M182K probably damaging Het
Stt3b T C 9: 115,248,617 E689G probably damaging Het
Tas1r1 A G 4: 152,032,251 Y309H probably benign Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tbc1d5 TGC TGCGGC 17: 50,799,935 probably benign Het
Tbc1d5 TGC TGCCGC 17: 50,799,941 probably benign Het
Tbc1d5 TG TGCGG 17: 50,799,950 probably benign Het
Tmem101 A G 11: 102,153,510 F184L probably benign Het
Zfp474 A G 18: 52,639,094 Q273R probably benign Het
Zfyve28 A G 5: 34,233,326 L197P probably damaging Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R0969:Suclg1 UTSW 6 73271116 missense probably benign 0.33
R1123:Suclg1 UTSW 6 73256227 missense probably benign 0.02
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R5083:Suclg1 UTSW 6 73263980 missense probably benign
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6313:Suclg1 UTSW 6 73256209 missense probably damaging 0.97
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
R7829:Suclg1 UTSW 6 73275243 splice site probably null
R8166:Suclg1 UTSW 6 73260572 missense probably damaging 1.00
R8721:Suclg1 UTSW 6 73269379 missense probably damaging 1.00
R8735:Suclg1 UTSW 6 73276746 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGAGCCATGCGTCATCTG -3'
(R):5'- AATGATGGGTGACGCCTGTAG -3'

Sequencing Primer
(F):5'- GAGAGCCATGCGTCATCTGAAATAC -3'
(R):5'- TGAACTCAGAATCTAGAACATCCTG -3'
Posted On2021-04-30