Incidental Mutation 'R8799:Zfp474'
ID671472
Institutional Source Beutler Lab
Gene Symbol Zfp474
Ensembl Gene ENSMUSG00000046886
Gene Namezinc finger protein 474
Synonyms4933409D10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8799 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location52615915-52639830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52639094 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 273 (Q273R)
Ref Sequence ENSEMBL: ENSMUSP00000072453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072666] [ENSMUST00000209270]
Predicted Effect probably benign
Transcript: ENSMUST00000072666
AA Change: Q273R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072453
Gene: ENSMUSG00000046886
AA Change: Q273R

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 90 114 1.8e-10 PFAM
Pfam:zf-C2HC_2 161 185 3.3e-13 PFAM
Pfam:zf-C2HC_2 217 241 1.2e-10 PFAM
low complexity region 250 267 N/A INTRINSIC
Pfam:zf-C2HC_2 280 304 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209270
AA Change: Q273R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,752 C134S probably damaging Het
Acox3 T G 5: 35,589,708 F156L probably damaging Het
Adprhl1 T C 8: 13,222,474 E1428G probably benign Het
Arhgap40 A T 2: 158,512,838 M15L probably benign Het
Bahcc1 C A 11: 120,286,347 F2020L probably damaging Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Ccdc40 C A 11: 119,264,466 S1177R probably benign Het
Ccne2 A T 4: 11,201,355 R294S probably benign Het
Cib1 A C 7: 80,232,543 S6R probably damaging Het
Csnk2a1 A G 2: 152,257,966 E114G probably damaging Het
Cxxc1 A G 18: 74,221,057 probably benign Het
Decr2 A C 17: 26,088,937 I47M possibly damaging Het
Dmxl2 A G 9: 54,419,743 probably null Het
Dse G A 10: 34,184,153 probably benign Het
Eml6 A G 11: 29,758,981 V1480A probably benign Het
Erap1 A G 13: 74,657,636 I165M probably benign Het
Fan1 G T 7: 64,366,658 Q573K probably damaging Het
Fndc3a G A 14: 72,556,515 T906I probably benign Het
Gm21915 A C 9: 40,670,710 H33P possibly damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Lama3 G T 18: 12,490,943 Q1384H probably damaging Het
Lrrc34 C T 3: 30,624,830 E373K probably benign Het
Ly75 A G 2: 60,348,441 F677L probably damaging Het
Megf11 A G 9: 64,681,391 D493G probably benign Het
Mta3 A T 17: 83,788,940 I348F possibly damaging Het
Myo1d A T 11: 80,684,379 F170L probably damaging Het
Nfkbia A G 12: 55,492,298 probably benign Het
Nfx1 A T 4: 41,023,727 E1045D probably damaging Het
Npffr2 T G 5: 89,583,318 V369G probably benign Het
Olfr1136 G T 2: 87,693,713 H56Q possibly damaging Het
Olfr1312 A T 2: 112,042,183 I283N probably damaging Het
Olfr141 A T 2: 86,806,231 M256K probably damaging Het
Olfr301 T C 7: 86,412,646 C95R probably damaging Het
Olfr984 A T 9: 40,100,689 M267K possibly damaging Het
Otoa G A 7: 121,092,671 E41K possibly damaging Het
Podxl A G 6: 31,524,465 V385A probably damaging Het
Ppp4r4 C T 12: 103,601,364 T673M possibly damaging Het
Rbm20 G T 19: 53,832,689 C525F probably damaging Het
Rnf17 A T 14: 56,500,429 E1222D probably damaging Het
Ros1 G A 10: 52,046,047 A2331V probably benign Het
Rrs1 T A 1: 9,545,594 I24N probably damaging Het
Sec11a A G 7: 80,935,102 V29A possibly damaging Het
Shisa3 T A 5: 67,611,406 Y216* probably null Het
Slc22a2 A T 17: 12,612,538 Y405F probably benign Het
Slc2a12 A T 10: 22,692,206 M511L possibly damaging Het
Slc38a9 T A 13: 112,703,602 H338Q probably damaging Het
Slco1c1 T G 6: 141,559,805 S486A probably benign Het
Slit2 T C 5: 48,304,182 S1524P possibly damaging Het
Spata31d1c T C 13: 65,036,326 S561P possibly damaging Het
Stac3 T A 10: 127,504,912 M182K probably damaging Het
Stt3b T C 9: 115,248,617 E689G probably damaging Het
Suclg1 A G 6: 73,271,108 K271E probably benign Het
Tas1r1 A G 4: 152,032,251 Y309H probably benign Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tbc1d5 TGC TGCGGC 17: 50,799,935 probably benign Het
Tbc1d5 TGC TGCCGC 17: 50,799,941 probably benign Het
Tbc1d5 TG TGCGG 17: 50,799,950 probably benign Het
Tmem101 A G 11: 102,153,510 F184L probably benign Het
Zfyve28 A G 5: 34,233,326 L197P probably damaging Het
Other mutations in Zfp474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp474 APN 18 52638493 missense possibly damaging 0.52
IGL01651:Zfp474 APN 18 52638583 missense probably damaging 1.00
IGL01750:Zfp474 APN 18 52639277 missense possibly damaging 0.59
IGL02013:Zfp474 APN 18 52638899 missense possibly damaging 0.86
PIT4469001:Zfp474 UTSW 18 52638719 missense possibly damaging 0.77
PIT4618001:Zfp474 UTSW 18 52638404 missense probably damaging 0.97
R0615:Zfp474 UTSW 18 52638349 missense probably benign 0.02
R1178:Zfp474 UTSW 18 52638742 nonsense probably null
R1180:Zfp474 UTSW 18 52638742 nonsense probably null
R1610:Zfp474 UTSW 18 52638365 missense probably benign
R1819:Zfp474 UTSW 18 52638800 missense probably damaging 1.00
R4854:Zfp474 UTSW 18 52638431 missense possibly damaging 0.59
R6270:Zfp474 UTSW 18 52638364 missense probably benign
R7574:Zfp474 UTSW 18 52639189 missense probably benign 0.00
R8194:Zfp474 UTSW 18 52639157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACCAAGGACTCTCATCTG -3'
(R):5'- AAATGACACCAGTTACCTTGTCC -3'

Sequencing Primer
(F):5'- CAAGGACTCTCATCTGTTACATTTG -3'
(R):5'- CCCATTGGGTGCTTCCATG -3'
Posted On2021-04-30