Incidental Mutation 'R8799:Ly75'
ID671417
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Namelymphocyte antigen 75
SynonymsDEC-205, CD205
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8799 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60292103-60383303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60348441 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 677 (F677L)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: F677L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: F677L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: F677L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: F677L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,752 C134S probably damaging Het
Acox3 T G 5: 35,589,708 F156L probably damaging Het
Adprhl1 T C 8: 13,222,474 E1428G probably benign Het
Arhgap40 A T 2: 158,512,838 M15L probably benign Het
Bahcc1 C A 11: 120,286,347 F2020L probably damaging Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Ccdc40 C A 11: 119,264,466 S1177R probably benign Het
Ccne2 A T 4: 11,201,355 R294S probably benign Het
Cib1 A C 7: 80,232,543 S6R probably damaging Het
Csnk2a1 A G 2: 152,257,966 E114G probably damaging Het
Cxxc1 A G 18: 74,221,057 probably benign Het
Decr2 A C 17: 26,088,937 I47M possibly damaging Het
Dmxl2 A G 9: 54,419,743 probably null Het
Dse G A 10: 34,184,153 probably benign Het
Eml6 A G 11: 29,758,981 V1480A probably benign Het
Erap1 A G 13: 74,657,636 I165M probably benign Het
Fan1 G T 7: 64,366,658 Q573K probably damaging Het
Fndc3a G A 14: 72,556,515 T906I probably benign Het
Gm21915 A C 9: 40,670,710 H33P possibly damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Lama3 G T 18: 12,490,943 Q1384H probably damaging Het
Lrrc34 C T 3: 30,624,830 E373K probably benign Het
Megf11 A G 9: 64,681,391 D493G probably benign Het
Mta3 A T 17: 83,788,940 I348F possibly damaging Het
Myo1d A T 11: 80,684,379 F170L probably damaging Het
Nfkbia A G 12: 55,492,298 probably benign Het
Nfx1 A T 4: 41,023,727 E1045D probably damaging Het
Npffr2 T G 5: 89,583,318 V369G probably benign Het
Olfr1136 G T 2: 87,693,713 H56Q possibly damaging Het
Olfr1312 A T 2: 112,042,183 I283N probably damaging Het
Olfr141 A T 2: 86,806,231 M256K probably damaging Het
Olfr301 T C 7: 86,412,646 C95R probably damaging Het
Olfr984 A T 9: 40,100,689 M267K possibly damaging Het
Otoa G A 7: 121,092,671 E41K possibly damaging Het
Podxl A G 6: 31,524,465 V385A probably damaging Het
Ppp4r4 C T 12: 103,601,364 T673M possibly damaging Het
Rbm20 G T 19: 53,832,689 C525F probably damaging Het
Rnf17 A T 14: 56,500,429 E1222D probably damaging Het
Ros1 G A 10: 52,046,047 A2331V probably benign Het
Rrs1 T A 1: 9,545,594 I24N probably damaging Het
Sec11a A G 7: 80,935,102 V29A possibly damaging Het
Shisa3 T A 5: 67,611,406 Y216* probably null Het
Slc22a2 A T 17: 12,612,538 Y405F probably benign Het
Slc2a12 A T 10: 22,692,206 M511L possibly damaging Het
Slc38a9 T A 13: 112,703,602 H338Q probably damaging Het
Slco1c1 T G 6: 141,559,805 S486A probably benign Het
Slit2 T C 5: 48,304,182 S1524P possibly damaging Het
Spata31d1c T C 13: 65,036,326 S561P possibly damaging Het
Stac3 T A 10: 127,504,912 M182K probably damaging Het
Stt3b T C 9: 115,248,617 E689G probably damaging Het
Suclg1 A G 6: 73,271,108 K271E probably benign Het
Tas1r1 A G 4: 152,032,251 Y309H probably benign Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tbc1d5 TGC TGCGGC 17: 50,799,935 probably benign Het
Tbc1d5 TGC TGCCGC 17: 50,799,941 probably benign Het
Tbc1d5 TG TGCGG 17: 50,799,950 probably benign Het
Tmem101 A G 11: 102,153,510 F184L probably benign Het
Zfp474 A G 18: 52,639,094 Q273R probably benign Het
Zfyve28 A G 5: 34,233,326 L197P probably damaging Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 splice site probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R7976:Ly75 UTSW 2 60365088 missense probably damaging 1.00
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
R8171:Ly75 UTSW 2 60314228 missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60349940 missense probably benign 0.00
R8705:Ly75 UTSW 2 60318385 missense probably damaging 0.98
R8714:Ly75 UTSW 2 60334485 missense probably damaging 1.00
R8798:Ly75 UTSW 2 60323926 missense probably benign 0.32
R8834:Ly75 UTSW 2 60331089 missense probably benign
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGTGAAGCATGGAATGGCTC -3'
(R):5'- ATGATGCAGCCGTCACTGTG -3'

Sequencing Primer
(F):5'- AAGCATGGAATGGCTCTTTAGATGC -3'
(R):5'- TGGCTTACCCTGGGCAG -3'
Posted On2021-04-30