Incidental Mutation 'R8926:Ces1a'
ID 679547
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Name carboxylesterase 1A
Synonyms Gm4976
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8926 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 93020214-93048192 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93025213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 431 (V431A)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
AlphaFold E9PYP1
Predicted Effect probably benign
Transcript: ENSMUST00000095211
AA Change: V431A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: V431A

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,444 C1611Y probably damaging Het
Adgrf3 T A 5: 30,200,448 D296V possibly damaging Het
Ahi1 T C 10: 21,055,083 Y941H probably damaging Het
Bscl2 T C 19: 8,847,984 probably null Het
C1s1 C T 6: 124,533,366 G374D probably damaging Het
C1s1 T C 6: 124,536,363 D235G possibly damaging Het
Cacna1e C T 1: 154,701,334 V106I possibly damaging Het
Ccdc97 G A 7: 25,713,069 A316V probably benign Het
Cftr C T 6: 18,268,004 S684L possibly damaging Het
Cgnl1 T A 9: 71,725,253 N272I probably benign Het
Csf2rb C T 15: 78,340,549 S169L probably benign Het
Cux1 T A 5: 136,309,550 probably benign Het
Cyp11b1 T A 15: 74,839,238 Y197F probably benign Het
Cyp1a2 T C 9: 57,681,078 K288E probably benign Het
Dapk1 T A 13: 60,760,920 W1116R probably damaging Het
Dclre1c A T 2: 3,433,790 D97V probably damaging Het
Efcc1 A G 6: 87,749,187 R323G probably benign Het
Epha6 T A 16: 59,839,299 I819F probably benign Het
Fam118b A T 9: 35,235,436 L45Q probably damaging Het
Fsd1l T G 4: 53,686,493 I302S probably benign Het
Fsip2 T A 2: 82,993,583 D6553E possibly damaging Het
Gje1 C T 10: 14,716,691 V116I probably benign Het
Gm7030 T A 17: 36,109,734 probably null Het
Helz C A 11: 107,672,683 H1650N unknown Het
Hltf T G 3: 20,069,159 probably null Het
Intu T A 3: 40,653,709 D50E possibly damaging Het
Ipo9 C T 1: 135,386,214 probably benign Het
Lama5 G A 2: 180,193,990 T1217I probably benign Het
Lct T A 1: 128,300,411 Y1115F probably damaging Het
Lpgat1 T C 1: 191,760,008 L202P probably damaging Het
Lrp1 C T 10: 127,545,802 R3801H probably benign Het
Mtfmt T A 9: 65,437,132 Y113* probably null Het
Myh7 A G 14: 54,985,076 F801L probably benign Het
Myl4 G T 11: 104,585,746 M191I probably benign Het
Myo3a C A 2: 22,396,263 N614K possibly damaging Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nol10 C A 12: 17,416,870 Q584K probably benign Het
Nup210 C A 6: 91,053,452 G919C probably damaging Het
Olfr480 G A 7: 108,066,306 T134I probably benign Het
Olfr53 G A 7: 140,652,200 V74M probably benign Het
Pdcd6ip T A 9: 113,685,425 Q244L probably benign Het
Pde4d T C 13: 109,938,091 V410A probably benign Het
Plekha7 A T 7: 116,156,988 probably benign Het
Plpp4 A T 7: 129,321,487 probably null Het
Poln T C 5: 34,129,425 N133S probably benign Het
Ppfibp1 A G 6: 147,019,488 N575D probably damaging Het
Prex2 T A 1: 11,089,706 probably null Het
Prkar2b A G 12: 32,061,081 M1T probably null Het
Ptcd3 A G 6: 71,892,480 F378S probably damaging Het
Rab27b C A 18: 69,996,073 R50L probably damaging Het
Rpl7a T G 2: 26,911,545 F83C probably damaging Het
Slc8a2 A G 7: 16,134,269 E142G probably damaging Het
Slc9a4 A T 1: 40,580,768 I85L possibly damaging Het
Sorcs1 C A 19: 50,252,658 W430L possibly damaging Het
Spaca6 T A 17: 17,838,528 probably null Het
Synrg C A 11: 83,990,741 A301E possibly damaging Het
Tcl1 G A 12: 105,218,710 probably benign Het
Tecpr1 C T 5: 144,216,962 V158M probably damaging Het
Tex2 T G 11: 106,568,404 T67P Het
Tlr9 A T 9: 106,226,014 I835L probably benign Het
Tmem185b G C 1: 119,526,676 V56L probably benign Het
Tssk2 C T 16: 17,899,698 R322W probably benign Het
Ttn T A 2: 76,741,391 Y26386F probably benign Het
Txndc16 C A 14: 45,169,314 R228I possibly damaging Het
Uspl1 T G 5: 149,201,891 probably null Het
Vmn1r113 A T 7: 20,787,949 H222L possibly damaging Het
Vnn1 T G 10: 23,900,689 S313A probably benign Het
Zc3hc1 A T 6: 30,374,888 L218Q possibly damaging Het
Znrf1 T G 8: 111,537,511 L124R probably damaging Het
Zzz3 A T 3: 152,427,892 N196Y possibly damaging Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1063:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1215:Ces1a UTSW 8 93032690 missense probably damaging 1.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1417:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93025225 missense probably damaging 1.00
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
R7390:Ces1a UTSW 8 93044841 splice site probably null
R9365:Ces1a UTSW 8 93048099 missense probably benign 0.00
R9582:Ces1a UTSW 8 93039528 missense probably benign 0.33
R9636:Ces1a UTSW 8 93032635 missense probably benign 0.17
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Z1176:Ces1a UTSW 8 93036085 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TCTTGTTTACAGGCAGGTTAGC -3'
(R):5'- GGAAAACATACGTTGCTCATTGC -3'

Sequencing Primer
(F):5'- TACAGATAGCCATGCCCATGTGTG -3'
(R):5'- CTCATTGCATGGGGGTGGAC -3'
Posted On 2021-08-02