Incidental Mutation 'R9008:Adprhl2'
ID 685419
Institutional Source Beutler Lab
Gene Symbol Adprhl2
Ensembl Gene ENSMUSG00000042558
Gene Name ADP-ribosylhydrolase like 2
Synonyms Arh3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9008 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126316047-126321703 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126316839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 283 (V283M)
Ref Sequence ENSEMBL: ENSMUSP00000099677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000102617]
AlphaFold Q8CG72
PDB Structure Crystal Structure of mouse ADP-ribosylhydrolase 3 (mARH3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000070132
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102617
AA Change: V283M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558
AA Change: V283M

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T G 15: 98,588,612 S88A possibly damaging Het
4930504O13Rik T A 11: 58,447,383 E61V probably benign Het
Abcc4 A T 14: 118,611,750 S536R probably damaging Het
Acsm1 T C 7: 119,659,102 Y473H probably benign Het
Adam30 T A 3: 98,162,718 C622* probably null Het
AI606181 G T 19: 41,593,593 R67S unknown Het
Btbd3 A G 2: 138,283,533 I212M probably benign Het
C1s1 C T 6: 124,532,540 probably null Het
C7 T A 15: 5,010,927 T539S Het
Cd5l A C 3: 87,368,665 D314A probably damaging Het
Celsr3 T A 9: 108,828,952 V878E possibly damaging Het
Cfap74 T C 4: 155,418,664 S38P Het
Chst2 C T 9: 95,406,294 probably benign Het
Deaf1 T C 7: 141,324,165 T103A probably damaging Het
Deup1 T A 9: 15,599,844 D213V probably damaging Het
Dhrs1 A G 14: 55,741,181 probably null Het
Dnah7a A G 1: 53,662,342 V218A possibly damaging Het
Dock7 G A 4: 98,945,211 Q1950* probably null Het
Ehf G A 2: 103,266,828 R283W Het
Elovl3 A T 19: 46,134,648 N221I possibly damaging Het
Gm11938 A T 11: 99,603,140 V43E probably damaging Het
Gm12394 C T 4: 42,792,546 G529S probably benign Het
Hnf4g A G 3: 3,643,036 N115S probably benign Het
Hnrnpr A T 4: 136,329,426 N246Y probably damaging Het
Itpka A G 2: 119,749,413 E211G probably damaging Het
Krt78 TAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA TAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA 15: 101,946,776 probably benign Het
Mgat5 T C 1: 127,479,571 I658T probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mov10 A G 3: 104,800,016 Y606H probably benign Het
Naa38 T G 11: 69,396,322 V76G probably damaging Het
Nelfe C A 17: 34,854,358 P290T possibly damaging Het
Nfil3 A T 13: 52,967,573 Y432N probably damaging Het
Nipbl T C 15: 8,327,124 K1593E probably damaging Het
Nlrc3 G C 16: 3,958,943 L56V possibly damaging Het
Nlrp1a A T 11: 71,123,909 F172I possibly damaging Het
Nudt2 G A 4: 41,480,288 R57Q probably damaging Het
Obsl1 A C 1: 75,505,383 L281W probably benign Het
Olfm4 A T 14: 80,018,167 N250I unknown Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr165 T A 16: 19,407,423 I198F probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Olfr456 T C 6: 42,486,969 S75G probably damaging Het
Olfr469 A G 7: 107,823,421 I16T possibly damaging Het
Pappa A T 4: 65,156,189 T327S probably damaging Het
Pcdhb4 T G 18: 37,307,661 M8R probably benign Het
Phf21b T A 15: 84,787,362 I444F probably damaging Het
Pkd1l2 A C 8: 117,042,298 V1205G probably benign Het
Plec T C 15: 76,176,032 Y3235C probably damaging Het
Pnmt C T 11: 98,388,006 T266I possibly damaging Het
Ppfia2 T A 10: 106,819,359 D262E probably benign Het
Rabggta A T 14: 55,718,456 L448Q probably damaging Het
Rap1gds1 C T 3: 138,955,416 R449H probably benign Het
Rttn T C 18: 89,009,432 F557S probably damaging Het
Ryr3 A G 2: 112,635,403 C4809R probably damaging Het
Sacs A C 14: 61,204,543 D1346A probably benign Het
Slain1 T A 14: 103,685,755 S261T probably damaging Het
Slc22a4 C T 11: 53,990,838 W351* probably null Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Spag17 C T 3: 100,027,626 S716F possibly damaging Het
Spg11 C T 2: 122,069,932 M1546I probably benign Het
Stac3 C T 10: 127,503,585 L117F probably damaging Het
Surf6 A G 2: 26,892,524 W264R probably damaging Het
Taar7e T C 10: 24,037,912 V100A probably damaging Het
Tenm3 T C 8: 48,342,653 H534R probably damaging Het
Tinagl1 C A 4: 130,174,030 R57L probably damaging Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Traf6 A G 2: 101,696,988 Y361C possibly damaging Het
Ufl1 A T 4: 25,254,778 Y559* probably null Het
Upk1b A T 16: 38,787,208 N52K probably damaging Het
Uqcrb A G 13: 66,905,299 S5P probably benign Het
Use1 A G 8: 71,367,044 Y3C unknown Het
Usp9y T A Y: 1,434,993 I279L possibly damaging Het
Vmn1r142 A G 7: 22,163,371 L222P probably damaging Het
Vmn1r184 A C 7: 26,267,752 N308H probably benign Het
Vmn2r14 C A 5: 109,220,027 M366I probably benign Het
Vmn2r73 G T 7: 85,872,696 S145Y probably damaging Het
Wdfy1 A T 1: 79,714,980 W207R probably damaging Het
Zbtb38 A T 9: 96,687,047 N661K probably benign Het
Zkscan3 G T 13: 21,388,213 H416Q possibly damaging Het
Other mutations in Adprhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Adprhl2 APN 4 126318481 missense probably damaging 1.00
IGL02391:Adprhl2 APN 4 126317908 splice site probably benign
IGL03189:Adprhl2 APN 4 126317294 splice site probably benign
R0139:Adprhl2 UTSW 4 126318154 missense probably damaging 1.00
R0302:Adprhl2 UTSW 4 126317392 missense probably benign 0.00
R0879:Adprhl2 UTSW 4 126316617 missense probably benign
R2008:Adprhl2 UTSW 4 126317344 missense probably benign 0.05
R3789:Adprhl2 UTSW 4 126316751 missense probably damaging 0.96
R5038:Adprhl2 UTSW 4 126317309 missense possibly damaging 0.69
R5058:Adprhl2 UTSW 4 126318445 missense probably damaging 1.00
R5724:Adprhl2 UTSW 4 126318076 missense probably damaging 1.00
R6171:Adprhl2 UTSW 4 126317317 missense probably damaging 1.00
R6326:Adprhl2 UTSW 4 126316613 missense possibly damaging 0.58
R7825:Adprhl2 UTSW 4 126321696 unclassified probably benign
R8552:Adprhl2 UTSW 4 126316575 makesense probably null
R9142:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321661 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGTCTGTCTCCTCAAAGCC -3'
(R):5'- AGGACTAAGTGGGACCCTTG -3'

Sequencing Primer
(F):5'- AAAGCCTTCACAACTTTGCTG -3'
(R):5'- TAAGTGGGACCCTTGCCTGG -3'
Posted On 2021-10-11