Mutagenetix > Incidental Mutation

Incidental Mutation 'R9008:Acacb'

723627

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9008 (G1)

Quality Score

152.008

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 114248754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

silent
Transcript: ENSMUST00000031583

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000102582

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415O20Rik	T	G	15: 98,588,612	S88A	possibly damaging	Het
4930504O13Rik	T	A	11: 58,447,383	E61V	probably benign	Het
Abcc4	A	T	14: 118,611,750	S536R	probably damaging	Het
Acsm1	T	C	7: 119,659,102	Y473H	probably benign	Het
Adam30	T	A	3: 98,162,718	C622*	probably null	Het
Adprhl2	C	T	4: 126,316,839	V283M	probably damaging	Het
AI606181	G	T	19: 41,593,593	R67S	unknown	Het
Btbd3	A	G	2: 138,283,533	I212M	probably benign	Het
C1s1	C	T	6: 124,532,540		probably null	Het
C7	T	A	15: 5,010,927	T539S		Het
Cd5l	A	C	3: 87,368,665	D314A	probably damaging	Het
Celsr3	T	A	9: 108,828,952	V878E	possibly damaging	Het
Cfap74	T	C	4: 155,418,664	S38P		Het
Chst2	C	T	9: 95,406,294		probably benign	Het
Deaf1	T	C	7: 141,324,165	T103A	probably damaging	Het
Deup1	T	A	9: 15,599,844	D213V	probably damaging	Het
Dhrs1	A	G	14: 55,741,181		probably null	Het
Dnah7a	A	G	1: 53,662,342	V218A	possibly damaging	Het
Dock7	G	A	4: 98,945,211	Q1950*	probably null	Het
Ehf	G	A	2: 103,266,828	R283W		Het
Elovl3	A	T	19: 46,134,648	N221I	possibly damaging	Het
Gm11938	A	T	11: 99,603,140	V43E	probably damaging	Het
Gm12394	C	T	4: 42,792,546	G529S	probably benign	Het
Hmcn1	T	C	1: 150,755,044		probably benign	Het
Hnf4g	A	G	3: 3,643,036	N115S	probably benign	Het
Hnrnpr	A	T	4: 136,329,426	N246Y	probably damaging	Het
Itpka	A	G	2: 119,749,413	E211G	probably damaging	Het
Krt78	TAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA	TAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA	15: 101,946,776		probably benign	Het
Lcorl	A	T	5: 45,774,174		probably benign	Het
Mgat5	T	C	1: 127,479,571	I658T	probably damaging	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mov10	A	G	3: 104,800,016	Y606H	probably benign	Het
Naa38	T	G	11: 69,396,322	V76G	probably damaging	Het
Nelfe	C	A	17: 34,854,358	P290T	possibly damaging	Het
Nfil3	A	T	13: 52,967,573	Y432N	probably damaging	Het
Nipbl	T	C	15: 8,327,124	K1593E	probably damaging	Het
Nlrc3	G	C	16: 3,958,943	L56V	possibly damaging	Het
Nlrp1a	A	T	11: 71,123,909	F172I	possibly damaging	Het
Ntn4	T	A	10: 93,733,604		probably benign	Het
Nudt2	G	A	4: 41,480,288	R57Q	probably damaging	Het
Obsl1	A	C	1: 75,505,383	L281W	probably benign	Het
Olfm4	A	T	14: 80,018,167	N250I	unknown	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr165	T	A	16: 19,407,423	I198F	probably benign	Het
Olfr432	T	A	1: 174,050,847	V158E	probably damaging	Het
Olfr456	T	C	6: 42,486,969	S75G	probably damaging	Het
Olfr469	A	G	7: 107,823,421	I16T	possibly damaging	Het
Pappa	A	T	4: 65,156,189	T327S	probably damaging	Het
Pcdhb4	T	G	18: 37,307,661	M8R	probably benign	Het
Phf21b	T	A	15: 84,787,362	I444F	probably damaging	Het
Pkd1l2	A	C	8: 117,042,298	V1205G	probably benign	Het
Plec	T	C	15: 76,176,032	Y3235C	probably damaging	Het
Pnmt	C	T	11: 98,388,006	T266I	possibly damaging	Het
Ppfia2	T	A	10: 106,819,359	D262E	probably benign	Het
Rabggta	A	T	14: 55,718,456	L448Q	probably damaging	Het
Rap1gds1	C	T	3: 138,955,416	R449H	probably benign	Het
Rictor	T	A	15: 6,772,129		probably benign	Het
Rttn	T	C	18: 89,009,432	F557S	probably damaging	Het
Ryr3	A	G	2: 112,635,403	C4809R	probably damaging	Het
Sacs	A	C	14: 61,204,543	D1346A	probably benign	Het
Slain1	T	A	14: 103,685,755	S261T	probably damaging	Het
Slc22a4	C	T	11: 53,990,838	W351*	probably null	Het
Smpd3	C	T	8: 106,257,426	G554S	probably benign	Het
Spag17	C	T	3: 100,027,626	S716F	possibly damaging	Het
Spg11	C	T	2: 122,069,932	M1546I	probably benign	Het
Stac3	C	T	10: 127,503,585	L117F	probably damaging	Het
Surf6	A	G	2: 26,892,524	W264R	probably damaging	Het
Taar7e	T	C	10: 24,037,912	V100A	probably damaging	Het
Tenm3	T	C	8: 48,342,653	H534R	probably damaging	Het
Tinagl1	C	A	4: 130,174,030	R57L	probably damaging	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Traf6	A	G	2: 101,696,988	Y361C	possibly damaging	Het
Ttn	A	T	2: 76,946,990		probably benign	Het
Ufl1	A	T	4: 25,254,778	Y559*	probably null	Het
Upk1b	A	T	16: 38,787,208	N52K	probably damaging	Het
Uqcrb	A	G	13: 66,905,299	S5P	probably benign	Het
Use1	A	G	8: 71,367,044	Y3C	unknown	Het
Usp9y	T	A	Y: 1,434,993	I279L	possibly damaging	Het
Vmn1r142	A	G	7: 22,163,371	L222P	probably damaging	Het
Vmn1r184	A	C	7: 26,267,752	N308H	probably benign	Het
Vmn2r14	C	A	5: 109,220,027	M366I	probably benign	Het
Vmn2r73	G	T	7: 85,872,696	S145Y	probably damaging	Het
Wdfy1	A	T	1: 79,714,980	W207R	probably damaging	Het
Zbtb38	A	T	9: 96,687,047	N661K	probably benign	Het
Zkscan3	G	T	13: 21,388,213	H416Q	possibly damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTGCTGGAATGGAAGACTGC -3'
(R):5'- AGTCCCGCTTCAGATAATTGATG -3'

Sequencing Primer
(F):5'- GAATGGAAGACTGCCCGCAC -3'
(R):5'- TGGCTGACCAGTGCTGTTCC -3'

Posted On

2022-09-08