Incidental Mutation 'R9183:Adgra1'
ID 697182
Institutional Source Beutler Lab
Gene Symbol Adgra1
Ensembl Gene ENSMUSG00000025475
Gene Name adhesion G protein-coupled receptor A1
Synonyms Gpr123, D7Ertd680e, 2900059M17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R9183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139834174-139878088 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139875800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 448 (R448Q)
Ref Sequence ENSEMBL: ENSMUSP00000026548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026548]
AlphaFold Q8C4G9
Predicted Effect probably benign
Transcript: ENSMUST00000026548
AA Change: R448Q

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026548
Gene: ENSMUSG00000025475
AA Change: R448Q

DomainStartEndE-ValueType
Pfam:7tm_2 19 307 1.4e-16 PFAM
low complexity region 407 419 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adhesion family of G-protein-coupled receptors. Members of this family function in several sensory systems and regulate blood pressure, immune responses, food intake and development. A similar protein in rodents is thought to play a role in in the regulation of neuronal signaling pathways. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 A G 14: 8,251,559 C313R probably damaging Het
Adap2 A G 11: 80,155,056 N54S probably damaging Het
Adcy8 T C 15: 64,822,267 D387G probably damaging Het
Antxr1 A T 6: 87,287,043 D148E probably damaging Het
Ap3d1 A T 10: 80,709,793 V1034E probably null Het
Arpp21 C T 9: 112,065,998 A731T probably benign Het
Asl T A 5: 130,013,471 R255W probably damaging Het
Asxl1 T A 2: 153,397,920 S544T probably damaging Het
Atp8a1 A C 5: 67,767,035 Y329D Het
Calcr A T 6: 3,711,463 I186N probably damaging Het
Cdh18 T C 15: 23,226,979 probably null Het
Celsr3 T C 9: 108,829,396 L1026P probably damaging Het
Ces2a T A 8: 104,734,142 V24E possibly damaging Het
Clybl T C 14: 122,401,975 I317T probably damaging Het
Col13a1 T A 10: 61,863,979 T476S unknown Het
Cyp4f15 T C 17: 32,700,231 S343P probably damaging Het
D230025D16Rik C A 8: 105,231,208 Q49K probably benign Het
D630003M21Rik T C 2: 158,217,192 T263A probably benign Het
Fbxo28 A G 1: 182,329,961 V97A possibly damaging Het
Frem2 C T 3: 53,520,065 V2889I probably damaging Het
Garnl3 T C 2: 33,005,068 E663G probably damaging Het
Gen1 T A 12: 11,249,185 K338M probably damaging Het
Gfi1 A G 5: 107,725,953 probably null Het
Gfod2 A G 8: 105,723,021 S95P probably benign Het
H2-Bl T A 17: 36,081,490 H31L unknown Het
Heatr1 A G 13: 12,421,385 Q1224R probably damaging Het
Hectd4 A G 5: 121,299,488 K1059E possibly damaging Het
Hmgcs2 C T 3: 98,290,916 A45V possibly damaging Het
Hnmt C A 2: 24,003,643 V280L probably benign Het
Ifi35 G T 11: 101,457,265 V66L probably benign Het
Kcnn2 T C 18: 45,561,312 I188T probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Krt6a T C 15: 101,693,011 D225G probably benign Het
Lrtm2 T C 6: 119,317,423 Y249C probably damaging Het
Med12l C T 3: 59,077,077 R479C probably damaging Het
Muc5ac A T 7: 141,798,900 Y709F possibly damaging Het
Nsd2 G A 5: 33,871,452 A162T probably damaging Het
Olfr768 A G 10: 129,093,332 M214T probably benign Het
Polr2h T C 16: 20,720,535 Y90H possibly damaging Het
Prkaa1 A T 15: 5,176,488 E275V probably damaging Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rhcg A T 7: 79,594,816 L496* probably null Het
Rnf213 A G 11: 119,427,622 E1084G Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Slc14a1 T A 18: 78,111,383 I263F probably benign Het
Slc40a1 C T 1: 45,909,511 M536I possibly damaging Het
Slco6c1 T A 1: 97,069,050 probably null Het
Stk32a T C 18: 43,261,340 F118S probably damaging Het
Sytl1 G T 4: 133,253,623 R467S possibly damaging Het
Thbs2 T C 17: 14,676,264 I788V probably benign Het
Tmed6 T A 8: 107,061,758 R186* probably null Het
Trnau1ap G A 4: 132,325,254 R78C probably damaging Het
Trpv1 A T 11: 73,244,213 D412V possibly damaging Het
Ttc16 C T 2: 32,757,317 V688M probably benign Het
Ubr5 C A 15: 37,997,176 L1738F Het
Vmn2r89 A G 14: 51,455,044 I101M probably benign Het
Wdr27 C T 17: 14,928,389 R114Q possibly damaging Het
Wdr48 A G 9: 119,920,664 H563R possibly damaging Het
Wdr49 A C 3: 75,298,112 S666A probably benign Het
Wwox T C 8: 114,706,370 S259P probably damaging Het
Zfp160 T A 17: 21,020,092 D12E possibly damaging Het
Zfp800 A G 6: 28,243,173 Y598H probably benign Het
Zfp970 T C 2: 177,475,743 L370P probably damaging Het
Zmat5 A T 11: 4,722,431 D16V probably damaging Het
Other mutations in Adgra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Adgra1 APN 7 139875944 missense probably benign 0.01
IGL01014:Adgra1 APN 7 139875660 missense probably benign 0.05
IGL01014:Adgra1 APN 7 139875661 missense probably damaging 1.00
IGL01068:Adgra1 APN 7 139845625 missense probably damaging 0.96
IGL01095:Adgra1 APN 7 139845654 missense possibly damaging 0.79
IGL02717:Adgra1 APN 7 139876178 missense probably damaging 0.98
adaga UTSW 7 139875280 missense probably damaging 1.00
I2288:Adgra1 UTSW 7 139852579 missense probably damaging 0.98
R0630:Adgra1 UTSW 7 139852584 nonsense probably null
R0653:Adgra1 UTSW 7 139876147 missense probably damaging 0.98
R1388:Adgra1 UTSW 7 139874003 missense probably damaging 0.97
R1462:Adgra1 UTSW 7 139875829 missense probably damaging 1.00
R1462:Adgra1 UTSW 7 139875829 missense probably damaging 1.00
R1667:Adgra1 UTSW 7 139845648 missense possibly damaging 0.95
R1770:Adgra1 UTSW 7 139874031 nonsense probably null
R2083:Adgra1 UTSW 7 139875631 missense probably damaging 0.99
R2967:Adgra1 UTSW 7 139875685 missense possibly damaging 0.68
R3410:Adgra1 UTSW 7 139847703 missense possibly damaging 0.94
R3411:Adgra1 UTSW 7 139847703 missense possibly damaging 0.94
R3687:Adgra1 UTSW 7 139852590 missense probably damaging 1.00
R3804:Adgra1 UTSW 7 139845594 missense probably benign 0.01
R3912:Adgra1 UTSW 7 139845714 critical splice donor site probably null
R4452:Adgra1 UTSW 7 139852521 missense probably benign 0.02
R4466:Adgra1 UTSW 7 139840836 intron probably benign
R4469:Adgra1 UTSW 7 139876061 missense probably damaging 0.96
R4675:Adgra1 UTSW 7 139876186 missense probably damaging 1.00
R4724:Adgra1 UTSW 7 139875589 missense probably benign
R5220:Adgra1 UTSW 7 139875596 missense probably benign 0.06
R5846:Adgra1 UTSW 7 139875280 missense probably damaging 1.00
R5972:Adgra1 UTSW 7 139845667 missense probably damaging 1.00
R6453:Adgra1 UTSW 7 139875427 missense probably benign 0.09
R7242:Adgra1 UTSW 7 139847657 critical splice acceptor site probably null
R7343:Adgra1 UTSW 7 139876142 missense probably damaging 1.00
R7774:Adgra1 UTSW 7 139847712 missense possibly damaging 0.79
R8190:Adgra1 UTSW 7 139876118 missense probably benign
R8355:Adgra1 UTSW 7 139875651 nonsense probably null
R8455:Adgra1 UTSW 7 139875651 nonsense probably null
R8905:Adgra1 UTSW 7 139875847 missense probably damaging 1.00
R9045:Adgra1 UTSW 7 139852650 missense possibly damaging 0.64
R9056:Adgra1 UTSW 7 139852576 missense probably damaging 1.00
R9438:Adgra1 UTSW 7 139852609 missense probably benign 0.00
V1662:Adgra1 UTSW 7 139852579 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCAGCTGTCTGTCACCTG -3'
(R):5'- CTTCGTAGCATCTCCAAGTGGG -3'

Sequencing Primer
(F):5'- TGCCACCCCGTGCTGTG -3'
(R):5'- AGGGCTTGTGTCTCCACC -3'
Posted On 2022-02-07