Mutagenetix > Incidental Mutation

Incidental Mutation 'R9184:Smad2'

697279

Institutional Source

Beutler Lab

Gene Symbol

Smad2

Ensembl Gene

ENSMUSG00000024563

Gene Name

SMAD family member 2

Synonyms

Smad 2, Madr2, 7120426M23Rik, Madh2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9184 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76241580-76305731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76289100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 194 (D194E)

Ref Sequence

ENSEMBL: ENSMUSP00000025453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]

AlphaFold

Q62432

Predicted Effect

probably benign
Transcript: ENSMUST00000025453
AA Change: D194E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: D194E

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091831
AA Change: D164E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: D164E

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	1e-10	BLAST
DWB	242	413	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113930
AA Change: D164E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: D164E

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	9e-11	BLAST
DWB	242	408	4.38e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165084

SMART Domains

Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	144	7.85e-67	SMART
PDB:1KHX\|A	166	204	3e-19	PDB
SCOP:d1khxa_	190	204	7e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168423
AA Change: D194E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: D194E

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171256
AA Change: D194E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: D194E

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWA	182	213	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172198

SMART Domains

Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
Pfam:MH2	28	58	1.8e-10	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,271,388	L692S	probably damaging	Het
6030452D12Rik	T	C	8: 106,507,269	V199A	unknown	Het
Abca7	A	G	10: 80,002,856	H621R	probably damaging	Het
Adam18	T	A	8: 24,647,831	N331I	probably benign	Het
Akt1	A	G	12: 112,654,718	S475P	possibly damaging	Het
Arc	A	G	15: 74,671,930	V148A	probably damaging	Het
Atg2a	T	C	19: 6,241,857	L21P	probably damaging	Het
C1qtnf2	T	C	11: 43,474,353	V25A	probably benign	Het
Cald1	G	T	6: 34,753,577	E244D	unknown	Het
Cdc42bpa	T	A	1: 180,144,736	F1368I	probably benign	Het
Cfap61	G	A	2: 146,077,388	C680Y	probably null	Het
Chd1	T	A	17: 15,742,289	N769K	possibly damaging	Het
Clasp1	T	A	1: 118,543,178	V848E	probably benign	Het
Col15a1	G	C	4: 47,288,200		probably benign	Het
Ctsb	G	T	14: 63,138,095	G170V	probably damaging	Het
Dnah5	A	G	15: 28,340,406	K2320E	probably benign	Het
Fat4	A	T	3: 38,982,443	I3415F	probably damaging	Het
Fibcd1	A	G	2: 31,816,476	S448P	probably damaging	Het
Filip1	T	C	9: 79,898,260	K71E	probably benign	Het
Gad2	G	A	2: 22,668,319	V350I	probably benign	Het
Gigyf2	T	A	1: 87,440,589	S1032T	possibly damaging	Het
Glis3	T	C	19: 28,531,607	T326A	probably damaging	Het
Hspa9	C	T	18: 34,949,115	R146H	possibly damaging	Het
Jakmip2	A	G	18: 43,582,287	I58T	probably benign	Het
Kcnk15	G	A	2: 163,858,686	V282M	probably benign	Het
Klk1b8	A	G	7: 43,952,734	N30S	probably benign	Het
Lpin2	T	A	17: 71,233,916	Y454*	probably null	Het
Mcam	T	C	9: 44,135,248		probably benign	Het
Mms22l	T	C	4: 24,596,182	L1047S	probably damaging	Het
Neb	A	G	2: 52,328,755	I81T	possibly damaging	Het
Neurod4	A	T	10: 130,271,089	D105E	probably damaging	Het
Nlrp1b	A	G	11: 71,181,241	L592P	probably damaging	Het
Nnt	C	A	13: 119,381,734	K302N	probably damaging	Het
Notch4	T	C	17: 34,587,390	F1767S	probably damaging	Het
Olfr1195	C	A	2: 88,683,175	A186S	possibly damaging	Het
Olfr48	T	A	2: 89,844,950	I8F	probably benign	Het
Olfr828	T	C	9: 18,815,842	I151V	probably benign	Het
Pcdhga4	A	T	18: 37,687,407	I670F	possibly damaging	Het
Pdp1	T	C	4: 11,962,143	E75G	possibly damaging	Het
Pds5b	T	A	5: 150,800,784	N1275K	probably benign	Het
Pink1	G	T	4: 138,321,010	Q134K	probably benign	Het
Poli	T	A	18: 70,509,179	H650L	probably damaging	Het
Prickle2	G	A	6: 92,411,524	P355L	possibly damaging	Het
Prkaca	G	A	8: 83,990,676	G194D	probably benign	Het
Ptgs2	A	T	1: 150,104,424	Y371F	probably damaging	Het
Rarb	C	T	14: 16,818,881		probably benign	Het
Rarb	T	A	14: 16,818,882		probably benign	Het
Safb2	ACTTCTTCT	ACTTCT	17: 56,571,292		probably benign	Het
Serpinb1b	T	G	13: 33,085,410	V42G	probably damaging	Het
Sgsm2	T	A	11: 74,892,008	I41F	possibly damaging	Het
Slc26a5	T	A	5: 21,813,882	D653V	probably damaging	Het
Slc26a7	C	T	4: 14,506,630	V602M	possibly damaging	Het
Slu7	T	C	11: 43,443,397	S417P	probably damaging	Het
Sntg1	A	T	1: 8,677,832	V112E	probably damaging	Het
Strip1	A	T	3: 107,614,663	M733K	probably benign	Het
Szt2	G	A	4: 118,384,529	S1655L	possibly damaging	Het
Ttn	A	T	2: 76,769,605	I19075N	probably benign	Het
Urb2	C	T	8: 124,045,151	T1437I	probably benign	Het
Vmn2r111	T	A	17: 22,571,841	I159F	probably benign	Het
Zfp78	T	C	7: 6,379,301	V450A	probably damaging	Het
Zmynd11	T	A	13: 9,693,439	H314L	probably benign	Het

Other mutations in Smad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Smad2	APN	18	76298495	missense	possibly damaging	0.94
IGL00978:Smad2	APN	18	76299775	splice site	probably benign
IGL01295:Smad2	APN	18	76302430	missense	probably benign	0.05
IGL01887:Smad2	APN	18	76299894	missense	probably damaging	1.00
IGL01960:Smad2	APN	18	76262484	intron	probably benign
IGL02881:Smad2	APN	18	76299780	splice site	probably null
IGL02977:Smad2	APN	18	76289164	missense	possibly damaging	0.64
R0333:Smad2	UTSW	18	76262621	missense	probably damaging	1.00
R0391:Smad2	UTSW	18	76289037	critical splice acceptor site	probably null
R0523:Smad2	UTSW	18	76262552	missense	probably benign
R0570:Smad2	UTSW	18	76289179	splice site	probably benign
R0624:Smad2	UTSW	18	76299993	missense	probably damaging	1.00
R1573:Smad2	UTSW	18	76262586	missense	possibly damaging	0.89
R1953:Smad2	UTSW	18	76262705	missense	possibly damaging	0.90
R2132:Smad2	UTSW	18	76288084	nonsense	probably null
R2213:Smad2	UTSW	18	76304626	missense	probably damaging	1.00
R3021:Smad2	UTSW	18	76262632	missense	probably damaging	1.00
R3917:Smad2	UTSW	18	76287937	missense	probably benign	0.42
R4503:Smad2	UTSW	18	76302592	missense	probably benign	0.23
R5253:Smad2	UTSW	18	76288053	missense	probably damaging	1.00
R5290:Smad2	UTSW	18	76262724	missense	probably damaging	1.00
R5891:Smad2	UTSW	18	76299975	missense	probably damaging	1.00
R6294:Smad2	UTSW	18	76289162	missense	probably benign	0.31
R6879:Smad2	UTSW	18	76262654	missense	possibly damaging	0.49
R7430:Smad2	UTSW	18	76288080	missense	probably damaging	1.00
R7503:Smad2	UTSW	18	76286885	missense	probably benign
R7757:Smad2	UTSW	18	76288013	missense	probably benign	0.40
R8072:Smad2	UTSW	18	76286951	critical splice donor site	probably null
R9132:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9159:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
Z1177:Smad2	UTSW	18	76288002	missense	probably damaging	1.00
Z1177:Smad2	UTSW	18	76288003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCAAGATGAGAATTGTCAGTTC -3'
(R):5'- AGGCTTTTCCATCCAAAGTCAAG -3'

Sequencing Primer
(F):5'- TTATAATAGCAGATAGGTGTGGCC -3'
(R):5'- TTTTCCATCCAAAGTCAAGAGCAC -3'

Posted On

2022-02-07