Incidental Mutation 'R0760:Rnf111'
ID70049
Institutional Source Beutler Lab
Gene Symbol Rnf111
Ensembl Gene ENSMUSG00000032217
Gene Namering finger 111
SynonymsArkadia
MMRRC Submission 038940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0760 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70425424-70503725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70429678 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 909 (V909A)
Ref Sequence ENSEMBL: ENSMUSP00000109225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]
Predicted Effect probably damaging
Transcript: ENSMUST00000034739
AA Change: V909A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: V909A

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 2.5e-112 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113595
AA Change: V909A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: V909A

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 1.8e-97 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213208
Predicted Effect probably benign
Transcript: ENSMUST00000213647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213996
Predicted Effect probably benign
Transcript: ENSMUST00000215848
Meta Mutation Damage Score 0.1438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,347,702 V120A possibly damaging Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Alcam C T 16: 52,295,672 V180M probably benign Het
Catip A G 1: 74,362,959 probably benign Het
Ccm2l A C 2: 153,072,184 N298T probably damaging Het
Ccni A G 5: 93,183,329 V261A possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5d1 A G 11: 69,395,173 F41L probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fbxw8 A G 5: 118,065,901 probably null Het
Gpaa1 T C 15: 76,331,919 I33T probably benign Het
Grip1 T A 10: 120,018,078 S512T probably damaging Het
Gtpbp1 G A 15: 79,719,155 G140E probably damaging Het
Hspa4l T A 3: 40,784,723 L681* probably null Het
Hspg2 A G 4: 137,512,349 T456A probably damaging Het
Igkv3-1 A T 6: 70,704,135 D106V probably damaging Het
Inhbc C T 10: 127,357,368 G260S probably damaging Het
Itga2 C T 13: 114,859,632 V708I possibly damaging Het
Kif5c T C 2: 49,688,753 I131T probably damaging Het
Kmt2c A G 5: 25,353,317 Y1133H possibly damaging Het
Lama2 A G 10: 27,044,433 probably null Het
N4bp1 A G 8: 86,846,912 Y744H probably damaging Het
Olfr128 C T 17: 37,924,114 Q183* probably null Het
Olfr354 A G 2: 36,907,221 S92G probably benign Het
Ovol2 A G 2: 144,331,759 probably null Het
Pappa2 C A 1: 158,716,961 probably null Het
Pcdh10 G A 3: 45,380,570 E440K probably benign Het
Pcsk4 A G 10: 80,325,941 probably benign Het
Plcl2 A G 17: 50,608,774 N937S possibly damaging Het
Ppp6r1 A G 7: 4,639,723 F541L probably benign Het
Rad54l2 A G 9: 106,719,606 probably null Het
Ranbp2 C T 10: 58,476,791 P1111L possibly damaging Het
Rasal3 A G 17: 32,392,172 F929S probably benign Het
Rnf168 A G 16: 32,298,386 probably null Het
Slc2a5 T C 4: 150,139,667 L244P probably benign Het
Snta1 T A 2: 154,380,940 I288F probably damaging Het
Sv2a G A 3: 96,188,182 C297Y probably damaging Het
Trim44 C T 2: 102,400,560 probably benign Het
Uggt1 A T 1: 36,161,724 I1164N possibly damaging Het
Other mutations in Rnf111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Rnf111 APN 9 70440858 missense probably damaging 1.00
IGL02567:Rnf111 APN 9 70459005 missense probably damaging 1.00
R0052:Rnf111 UTSW 9 70476389 missense probably benign 0.00
R0245:Rnf111 UTSW 9 70453831 splice site probably benign
R1327:Rnf111 UTSW 9 70453816 missense possibly damaging 0.60
R1778:Rnf111 UTSW 9 70476112 missense probably benign 0.00
R1884:Rnf111 UTSW 9 70476238 missense probably damaging 0.99
R1892:Rnf111 UTSW 9 70476374 missense probably damaging 1.00
R2261:Rnf111 UTSW 9 70476391 missense probably benign
R2762:Rnf111 UTSW 9 70476045 missense possibly damaging 0.82
R3980:Rnf111 UTSW 9 70442325 missense probably damaging 1.00
R4577:Rnf111 UTSW 9 70429584 nonsense probably null
R4631:Rnf111 UTSW 9 70450396 missense probably benign 0.07
R4804:Rnf111 UTSW 9 70430957 missense possibly damaging 0.70
R5153:Rnf111 UTSW 9 70476140 missense probably benign 0.35
R5500:Rnf111 UTSW 9 70476043 missense possibly damaging 0.94
R5546:Rnf111 UTSW 9 70459096 missense probably benign 0.05
R5975:Rnf111 UTSW 9 70429580 missense probably damaging 1.00
R6395:Rnf111 UTSW 9 70476410 missense possibly damaging 0.95
R6482:Rnf111 UTSW 9 70429607 missense probably damaging 1.00
R7056:Rnf111 UTSW 9 70453675 missense possibly damaging 0.60
R7239:Rnf111 UTSW 9 70469373 missense probably damaging 1.00
R7444:Rnf111 UTSW 9 70440843 missense probably damaging 1.00
R7618:Rnf111 UTSW 9 70503332 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTCGTGACCAGTTGATCC -3'
(R):5'- GTGTCAATCAGGCATTACCACTACATCC -3'

Sequencing Primer
(F):5'- gcactttgccactgagcc -3'
(R):5'- GCATTACCACTACATCCTGTCTAAAC -3'
Posted On2013-09-30