Incidental Mutation 'I1329:Glrb'
ID26486
Institutional Source Beutler Lab
Gene Symbol Glrb
Ensembl Gene ENSMUSG00000028020
Gene Nameglycine receptor, beta subunit
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location80843599-80913660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80862074 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 115 (R115S)
Ref Sequence ENSEMBL: ENSMUSP00000142306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029654] [ENSMUST00000107743] [ENSMUST00000132330] [ENSMUST00000135043] [ENSMUST00000194085]
Predicted Effect probably damaging
Transcript: ENSMUST00000029654
AA Change: R115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029654
Gene: ENSMUSG00000028020
AA Change: R115S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 6.9e-55 PFAM
Pfam:Neur_chan_memb 273 492 4.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107743
AA Change: R115S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103372
Gene: ENSMUSG00000028020
AA Change: R115S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 5.7e-58 PFAM
Pfam:Neur_chan_memb 273 302 9.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132330
SMART Domains Protein: ENSMUSP00000115014
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135043
SMART Domains Protein: ENSMUSP00000116604
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193031
Predicted Effect probably damaging
Transcript: ENSMUST00000194085
AA Change: R115S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142306
Gene: ENSMUSG00000028020
AA Change: R115S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 264 6.9e-55 PFAM
Pfam:Neur_chan_memb 248 441 1.1e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. This gene is transcribed throughout the central nervous system of neonatal and adult mice. In humans, mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mutations in this gene result in a neurological disorder and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Glrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Glrb APN 3 80861955 missense probably damaging 1.00
IGL00850:Glrb APN 3 80861781 missense probably damaging 1.00
IGL01970:Glrb APN 3 80861925 missense possibly damaging 0.92
IGL02023:Glrb APN 3 80850955 missense probably benign 0.22
IGL02494:Glrb APN 3 80845232 missense probably benign 0.01
IGL02703:Glrb APN 3 80850993 missense probably benign 0.19
R0003:Glrb UTSW 3 80855914 missense probably damaging 1.00
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0743:Glrb UTSW 3 80879680 missense probably damaging 1.00
R1367:Glrb UTSW 3 80862004 missense probably damaging 1.00
R1491:Glrb UTSW 3 80911975 missense possibly damaging 0.81
R1699:Glrb UTSW 3 80861774 missense probably damaging 1.00
R1791:Glrb UTSW 3 80860175 missense probably damaging 1.00
R1802:Glrb UTSW 3 80861957 missense probably damaging 1.00
R2420:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2422:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2517:Glrb UTSW 3 80861747 missense probably damaging 1.00
R3612:Glrb UTSW 3 80862030 missense possibly damaging 0.89
R4287:Glrb UTSW 3 80845232 missense possibly damaging 0.84
R4382:Glrb UTSW 3 80879639 missense probably damaging 1.00
R4546:Glrb UTSW 3 80879686 missense probably damaging 0.99
R4874:Glrb UTSW 3 80851042 missense possibly damaging 0.84
R5816:Glrb UTSW 3 80861979 missense probably damaging 1.00
R5826:Glrb UTSW 3 80845142 missense probably damaging 0.99
R6711:Glrb UTSW 3 80844974 missense probably benign 0.02
R7738:Glrb UTSW 3 80860184 missense probably damaging 0.98
R8206:Glrb UTSW 3 80851066 missense probably damaging 1.00
Z1088:Glrb UTSW 3 80845234 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGGAATCATTGAGCGTACATCGCTG -3'
(R):5'- GCAGGAAGAGCCACTGGTATCTTTAG -3'

Sequencing Primer
(F):5'- GTACATCGCTGAGATCCACTG -3'
(R):5'- CTCTTTTAGATGATGCTATCACTCAG -3'
Posted On2013-04-16