Mutagenetix > Incidental Mutation

Incidental Mutation 'R9530:Garre1'

719438

Institutional Source

Beutler Lab

Gene Symbol

Garre1

Ensembl Gene

ENSMUSG00000066571

Gene Name

granule associated Rac and RHOG effector 1

Synonyms

4931406P16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9530 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33936132-34012976 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33963069 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 201 (V201A)

Ref Sequence

ENSEMBL: ENSMUSP00000082730 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000206399]

AlphaFold

Q8C5X1

Predicted Effect

probably benign
Transcript: ENSMUST00000085592
AA Change: V201A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: V201A

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
Pfam:DUF4745	59	187	1.3e-57	PFAM
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: V201A

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206399

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,274,165 (GRCm39)	N96S	possibly damaging	Het
Acsl6	C	T	11: 54,220,783 (GRCm39)	T301I	probably damaging	Het
Ankrd7	C	A	6: 18,868,258 (GRCm39)	Q127K	probably benign	Het
Ap1s1	T	C	5: 137,064,612 (GRCm39)	M155V	probably benign	Het
Appbp2	A	C	11: 85,107,306 (GRCm39)	C61W	probably damaging	Het
Atosb	C	T	4: 43,034,753 (GRCm39)	R322Q	probably damaging	Het
Ccng1	A	G	11: 40,644,885 (GRCm39)	V4A	probably benign	Het
Cd163	G	T	6: 124,294,491 (GRCm39)	E550*	probably null	Het
Cdh2	A	G	18: 16,783,466 (GRCm39)	Y88H	probably damaging	Het
Cyp2c69	A	G	19: 39,848,311 (GRCm39)	S304P	possibly damaging	Het
Dync2i1	A	G	12: 116,175,411 (GRCm39)	I922T	possibly damaging	Het
Erbb3	T	C	10: 128,410,291 (GRCm39)	I656V	probably benign	Het
Fhod3	T	A	18: 25,248,910 (GRCm39)	I1363K	probably damaging	Het
Heatr1	G	A	13: 12,439,607 (GRCm39)	R1395H	probably damaging	Het
Herc4	T	C	10: 63,126,382 (GRCm39)	I578T	probably benign	Het
Herc6	T	A	6: 57,602,899 (GRCm39)	L526*	probably null	Het
Ighv5-9	A	G	12: 113,625,677 (GRCm39)	M22T	probably benign	Het
Klhl36	A	G	8: 120,591,808 (GRCm39)	E17G	possibly damaging	Het
Mast2	A	C	4: 116,169,535 (GRCm39)	L766R	probably damaging	Het
Megf8	G	A	7: 25,030,124 (GRCm39)	V420M	probably benign	Het
Met	T	C	6: 17,558,831 (GRCm39)	V1153A	probably damaging	Het
Mrpl21	T	A	19: 3,340,998 (GRCm39)	I196N	possibly damaging	Het
Or7g21	G	A	9: 19,033,051 (GRCm39)	V264I	probably benign	Het
Polrmt	C	T	10: 79,574,545 (GRCm39)	A883T	probably benign	Het
Prkcg	G	A	7: 3,375,965 (GRCm39)	D537N	possibly damaging	Het
Rpap3	A	T	15: 97,579,655 (GRCm39)	D452E	probably benign	Het
Slc8a2	A	G	7: 15,879,269 (GRCm39)	D585G	probably null	Het
St18	T	A	1: 6,872,997 (GRCm39)	I244N	probably benign	Het
Stat1	T	A	1: 52,187,160 (GRCm39)		probably null	Het
Stk39	A	G	2: 68,198,755 (GRCm39)	Y288H	probably damaging	Het
Tas2r140	G	A	6: 133,032,494 (GRCm39)	S88F	probably benign	Het
Tbc1d32	T	C	10: 56,072,507 (GRCm39)	E308G	probably damaging	Het
Tcf7l1	T	C	6: 72,604,687 (GRCm39)	T486A	probably benign	Het
Tie1	T	C	4: 118,343,817 (GRCm39)	T42A	possibly damaging	Het
Tnnt2	A	G	1: 135,779,793 (GRCm39)	T297A	possibly damaging	Het
Triobp	G	C	15: 78,886,321 (GRCm39)	G1867R	probably damaging	Het
Vmn1r234	A	G	17: 21,449,104 (GRCm39)	H6R	probably damaging	Het
Vmn2r93	T	A	17: 18,518,562 (GRCm39)	I7N	probably damaging	Het
Vwa8	T	A	14: 79,172,639 (GRCm39)	S294T	probably benign	Het
Yjefn3	A	G	8: 70,340,633 (GRCm39)	V197A	probably benign	Het
Zcchc4	CAGAG	CAG	5: 52,953,568 (GRCm39)		probably null	Het
Zfhx3	A	G	8: 109,527,010 (GRCm39)	E969G	probably damaging	Het
Zfp112	G	T	7: 23,824,665 (GRCm39)	C215F	probably benign	Het
Zfp994	A	T	17: 22,420,514 (GRCm39)	L145Q	probably damaging	Het

Other mutations in Garre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Garre1	APN	7	33,945,412 (GRCm39)	splice site	probably benign
IGL00160:Garre1	APN	7	33,938,431 (GRCm39)	missense	possibly damaging	0.88
IGL00691:Garre1	APN	7	33,944,910 (GRCm39)	missense	probably damaging	1.00
IGL01312:Garre1	APN	7	33,955,933 (GRCm39)	missense	probably benign	0.19
IGL01954:Garre1	APN	7	33,944,460 (GRCm39)	missense	probably damaging	1.00
IGL02016:Garre1	APN	7	33,938,526 (GRCm39)	missense	possibly damaging	0.74
IGL02390:Garre1	APN	7	33,947,643 (GRCm39)	missense	probably damaging	1.00
IGL02407:Garre1	APN	7	33,955,909 (GRCm39)	missense	probably damaging	0.99
IGL02677:Garre1	APN	7	33,941,834 (GRCm39)	splice site	probably benign
IGL02929:Garre1	APN	7	33,944,507 (GRCm39)	missense	possibly damaging	0.46
IGL03285:Garre1	APN	7	33,984,416 (GRCm39)	missense	possibly damaging	0.81
I1329:Garre1	UTSW	7	33,944,619 (GRCm39)	missense	probably benign	0.00
R0004:Garre1	UTSW	7	33,955,853 (GRCm39)	missense	probably damaging	0.99
R0100:Garre1	UTSW	7	33,953,436 (GRCm39)	missense	possibly damaging	0.95
R0100:Garre1	UTSW	7	33,953,436 (GRCm39)	missense	possibly damaging	0.95
R0135:Garre1	UTSW	7	33,945,382 (GRCm39)	missense	probably damaging	1.00
R0137:Garre1	UTSW	7	33,938,644 (GRCm39)	missense	probably damaging	1.00
R0556:Garre1	UTSW	7	33,939,222 (GRCm39)	missense	probably damaging	0.99
R0687:Garre1	UTSW	7	33,944,843 (GRCm39)	missense	possibly damaging	0.95
R0928:Garre1	UTSW	7	33,947,671 (GRCm39)	splice site	probably null
R1719:Garre1	UTSW	7	33,947,631 (GRCm39)	missense	probably damaging	0.98
R1908:Garre1	UTSW	7	33,957,461 (GRCm39)	missense	probably benign	0.14
R1909:Garre1	UTSW	7	33,957,461 (GRCm39)	missense	probably benign	0.14
R1976:Garre1	UTSW	7	33,956,805 (GRCm39)	missense	probably damaging	0.99
R2496:Garre1	UTSW	7	33,955,916 (GRCm39)	missense	possibly damaging	0.93
R3005:Garre1	UTSW	7	33,984,209 (GRCm39)	missense	probably damaging	1.00
R4666:Garre1	UTSW	7	33,984,198 (GRCm39)	missense	probably damaging	0.98
R4832:Garre1	UTSW	7	33,938,333 (GRCm39)	utr 3 prime	probably benign
R4870:Garre1	UTSW	7	33,984,312 (GRCm39)	missense	possibly damaging	0.83
R4989:Garre1	UTSW	7	33,945,225 (GRCm39)	missense	probably damaging	1.00
R5033:Garre1	UTSW	7	33,945,237 (GRCm39)	missense	probably benign
R5308:Garre1	UTSW	7	33,945,180 (GRCm39)	nonsense	probably null
R5366:Garre1	UTSW	7	33,941,713 (GRCm39)	missense	possibly damaging	0.74
R5386:Garre1	UTSW	7	33,941,813 (GRCm39)	missense	probably damaging	0.99
R5688:Garre1	UTSW	7	33,984,134 (GRCm39)	missense	probably damaging	0.99
R5688:Garre1	UTSW	7	33,953,416 (GRCm39)	missense	possibly damaging	0.74
R5714:Garre1	UTSW	7	33,939,941 (GRCm39)	nonsense	probably null
R5733:Garre1	UTSW	7	33,944,505 (GRCm39)	missense	probably damaging	0.99
R5772:Garre1	UTSW	7	33,953,413 (GRCm39)	missense	probably damaging	0.97
R6059:Garre1	UTSW	7	33,944,888 (GRCm39)	missense	possibly damaging	0.90
R6211:Garre1	UTSW	7	33,938,429 (GRCm39)	missense	possibly damaging	0.95
R6276:Garre1	UTSW	7	33,941,802 (GRCm39)	nonsense	probably null
R6477:Garre1	UTSW	7	33,957,055 (GRCm39)	critical splice donor site	probably null
R6757:Garre1	UTSW	7	33,938,502 (GRCm39)	missense	possibly damaging	0.89
R6912:Garre1	UTSW	7	33,945,093 (GRCm39)	missense	probably benign
R7156:Garre1	UTSW	7	33,945,133 (GRCm39)	missense	possibly damaging	0.80
R7317:Garre1	UTSW	7	33,963,072 (GRCm39)	missense	probably benign
R7431:Garre1	UTSW	7	33,984,219 (GRCm39)	missense	possibly damaging	0.73
R7452:Garre1	UTSW	7	33,945,096 (GRCm39)	missense	probably benign
R7996:Garre1	UTSW	7	33,963,024 (GRCm39)	missense	possibly damaging	0.77
R8348:Garre1	UTSW	7	33,984,569 (GRCm39)	missense	probably damaging	1.00
R8448:Garre1	UTSW	7	33,984,569 (GRCm39)	missense	probably damaging	1.00
R8989:Garre1	UTSW	7	33,956,869 (GRCm39)	missense	probably damaging	0.99
R9010:Garre1	UTSW	7	33,938,491 (GRCm39)	missense	probably benign	0.01
R9095:Garre1	UTSW	7	33,956,770 (GRCm39)	critical splice donor site	probably null
R9505:Garre1	UTSW	7	33,984,371 (GRCm39)	missense	probably damaging	1.00
R9612:Garre1	UTSW	7	33,947,656 (GRCm39)	missense	probably damaging	1.00
RF019:Garre1	UTSW	7	33,939,974 (GRCm39)	missense	probably damaging	0.98
X0021:Garre1	UTSW	7	33,944,788 (GRCm39)	missense	possibly damaging	0.94
Z1177:Garre1	UTSW	7	33,984,180 (GRCm39)	missense	probably damaging	0.96
Z1186:Garre1	UTSW	7	33,945,185 (GRCm39)	missense	probably benign
Z1186:Garre1	UTSW	7	33,938,583 (GRCm39)	missense	probably benign	0.03
Z1186:Garre1	UTSW	7	33,938,533 (GRCm39)	missense	probably benign
Z1191:Garre1	UTSW	7	33,945,185 (GRCm39)	missense	probably benign
Z1191:Garre1	UTSW	7	33,938,583 (GRCm39)	missense	probably benign	0.03
Z1191:Garre1	UTSW	7	33,938,533 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCACTGCAGTTTGTTCTC -3'
(R):5'- GACAGTTGAGGAGTTACTGCAC -3'

Sequencing Primer
(F):5'- TGCATGCCCTGAGTTCAAG -3'
(R):5'- GGAGTTACTGCACTAATCCATGAGC -3'

Posted On

2022-07-18