Mutagenetix > Incidental Mutation

Incidental Mutation 'R6757:Garre1'

531088

Institutional Source

Beutler Lab

Gene Symbol

Garre1

Ensembl Gene

ENSMUSG00000066571

Gene Name

granule associated Rac and RHOG effector 1

Synonyms

4931406P16Rik

MMRRC Submission

044873-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6757 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33936132-34012976 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33938502 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 799 (A799V)

Ref Sequence

ENSEMBL: ENSMUSP00000145762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]

AlphaFold

Q8C5X1

Predicted Effect

probably benign
Transcript: ENSMUST00000085592
AA Change: A1011V

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: A1011V

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
Pfam:DUF4745	59	187	1.3e-57	PFAM
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108074
AA Change: A1011V

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: A1011V

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140881

Predicted Effect

probably benign
Transcript: ENSMUST00000205264

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205940

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206245

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206399
AA Change: A799V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,666,558 (GRCm39)	*288Y	probably null	Het
Art2a	G	T	7: 101,204,221 (GRCm39)	L106I	probably benign	Het
Bmi1	C	T	2: 18,688,840 (GRCm39)	T203M	probably damaging	Het
Cpm	A	G	10: 117,507,543 (GRCm39)	D220G	probably damaging	Het
Cyp2a22	A	C	7: 26,638,629 (GRCm39)	D52E	probably benign	Het
Dag1	A	C	9: 108,095,216 (GRCm39)	I92S	probably damaging	Het
Dntt	A	T	19: 41,025,601 (GRCm39)	H73L	probably damaging	Het
Epha5	A	C	5: 84,253,737 (GRCm39)	I716S	probably damaging	Het
Fpr-rs4	C	T	17: 18,242,394 (GRCm39)	Q134*	probably null	Het
Fzd8	T	A	18: 9,213,238 (GRCm39)	C107S	possibly damaging	Het
Gnptab	T	C	10: 88,273,364 (GRCm39)	L1047P	probably damaging	Het
Gstt1	A	T	10: 75,634,217 (GRCm39)		probably null	Het
Kdm2a	T	C	19: 4,369,271 (GRCm39)	R1115G	probably damaging	Het
Myl10	G	C	5: 136,726,825 (GRCm39)	V70L	probably benign	Het
Myo1b	C	T	1: 51,852,207 (GRCm39)	E179K	probably damaging	Het
Nrp1	T	A	8: 129,152,349 (GRCm39)	I186N	probably damaging	Het
Or10g3	A	G	14: 52,610,172 (GRCm39)	C113R	probably damaging	Het
Pole	T	C	5: 110,451,476 (GRCm39)	V835A	probably damaging	Het
Shprh	A	G	10: 11,057,252 (GRCm39)		probably null	Het
Slc39a14	A	T	14: 70,548,333 (GRCm39)	L238Q	probably damaging	Het
Spata31e5	A	C	1: 28,819,191 (GRCm39)	I30S	probably damaging	Het
Usp40	A	T	1: 87,907,759 (GRCm39)	I619N	probably damaging	Het

Other mutations in Garre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Garre1	APN	7	33,945,412 (GRCm39)	splice site	probably benign
IGL00160:Garre1	APN	7	33,938,431 (GRCm39)	missense	possibly damaging	0.88
IGL00691:Garre1	APN	7	33,944,910 (GRCm39)	missense	probably damaging	1.00
IGL01312:Garre1	APN	7	33,955,933 (GRCm39)	missense	probably benign	0.19
IGL01954:Garre1	APN	7	33,944,460 (GRCm39)	missense	probably damaging	1.00
IGL02016:Garre1	APN	7	33,938,526 (GRCm39)	missense	possibly damaging	0.74
IGL02390:Garre1	APN	7	33,947,643 (GRCm39)	missense	probably damaging	1.00
IGL02407:Garre1	APN	7	33,955,909 (GRCm39)	missense	probably damaging	0.99
IGL02677:Garre1	APN	7	33,941,834 (GRCm39)	splice site	probably benign
IGL02929:Garre1	APN	7	33,944,507 (GRCm39)	missense	possibly damaging	0.46
IGL03285:Garre1	APN	7	33,984,416 (GRCm39)	missense	possibly damaging	0.81
I1329:Garre1	UTSW	7	33,944,619 (GRCm39)	missense	probably benign	0.00
R0004:Garre1	UTSW	7	33,955,853 (GRCm39)	missense	probably damaging	0.99
R0100:Garre1	UTSW	7	33,953,436 (GRCm39)	missense	possibly damaging	0.95
R0100:Garre1	UTSW	7	33,953,436 (GRCm39)	missense	possibly damaging	0.95
R0135:Garre1	UTSW	7	33,945,382 (GRCm39)	missense	probably damaging	1.00
R0137:Garre1	UTSW	7	33,938,644 (GRCm39)	missense	probably damaging	1.00
R0556:Garre1	UTSW	7	33,939,222 (GRCm39)	missense	probably damaging	0.99
R0687:Garre1	UTSW	7	33,944,843 (GRCm39)	missense	possibly damaging	0.95
R0928:Garre1	UTSW	7	33,947,671 (GRCm39)	splice site	probably null
R1719:Garre1	UTSW	7	33,947,631 (GRCm39)	missense	probably damaging	0.98
R1908:Garre1	UTSW	7	33,957,461 (GRCm39)	missense	probably benign	0.14
R1909:Garre1	UTSW	7	33,957,461 (GRCm39)	missense	probably benign	0.14
R1976:Garre1	UTSW	7	33,956,805 (GRCm39)	missense	probably damaging	0.99
R2496:Garre1	UTSW	7	33,955,916 (GRCm39)	missense	possibly damaging	0.93
R3005:Garre1	UTSW	7	33,984,209 (GRCm39)	missense	probably damaging	1.00
R4666:Garre1	UTSW	7	33,984,198 (GRCm39)	missense	probably damaging	0.98
R4832:Garre1	UTSW	7	33,938,333 (GRCm39)	utr 3 prime	probably benign
R4870:Garre1	UTSW	7	33,984,312 (GRCm39)	missense	possibly damaging	0.83
R4989:Garre1	UTSW	7	33,945,225 (GRCm39)	missense	probably damaging	1.00
R5033:Garre1	UTSW	7	33,945,237 (GRCm39)	missense	probably benign
R5308:Garre1	UTSW	7	33,945,180 (GRCm39)	nonsense	probably null
R5366:Garre1	UTSW	7	33,941,713 (GRCm39)	missense	possibly damaging	0.74
R5386:Garre1	UTSW	7	33,941,813 (GRCm39)	missense	probably damaging	0.99
R5688:Garre1	UTSW	7	33,984,134 (GRCm39)	missense	probably damaging	0.99
R5688:Garre1	UTSW	7	33,953,416 (GRCm39)	missense	possibly damaging	0.74
R5714:Garre1	UTSW	7	33,939,941 (GRCm39)	nonsense	probably null
R5733:Garre1	UTSW	7	33,944,505 (GRCm39)	missense	probably damaging	0.99
R5772:Garre1	UTSW	7	33,953,413 (GRCm39)	missense	probably damaging	0.97
R6059:Garre1	UTSW	7	33,944,888 (GRCm39)	missense	possibly damaging	0.90
R6211:Garre1	UTSW	7	33,938,429 (GRCm39)	missense	possibly damaging	0.95
R6276:Garre1	UTSW	7	33,941,802 (GRCm39)	nonsense	probably null
R6477:Garre1	UTSW	7	33,957,055 (GRCm39)	critical splice donor site	probably null
R6912:Garre1	UTSW	7	33,945,093 (GRCm39)	missense	probably benign
R7156:Garre1	UTSW	7	33,945,133 (GRCm39)	missense	possibly damaging	0.80
R7317:Garre1	UTSW	7	33,963,072 (GRCm39)	missense	probably benign
R7431:Garre1	UTSW	7	33,984,219 (GRCm39)	missense	possibly damaging	0.73
R7452:Garre1	UTSW	7	33,945,096 (GRCm39)	missense	probably benign
R7996:Garre1	UTSW	7	33,963,024 (GRCm39)	missense	possibly damaging	0.77
R8348:Garre1	UTSW	7	33,984,569 (GRCm39)	missense	probably damaging	1.00
R8448:Garre1	UTSW	7	33,984,569 (GRCm39)	missense	probably damaging	1.00
R8989:Garre1	UTSW	7	33,956,869 (GRCm39)	missense	probably damaging	0.99
R9010:Garre1	UTSW	7	33,938,491 (GRCm39)	missense	probably benign	0.01
R9095:Garre1	UTSW	7	33,956,770 (GRCm39)	critical splice donor site	probably null
R9505:Garre1	UTSW	7	33,984,371 (GRCm39)	missense	probably damaging	1.00
R9530:Garre1	UTSW	7	33,963,069 (GRCm39)	missense	probably benign	0.01
R9612:Garre1	UTSW	7	33,947,656 (GRCm39)	missense	probably damaging	1.00
RF019:Garre1	UTSW	7	33,939,974 (GRCm39)	missense	probably damaging	0.98
X0021:Garre1	UTSW	7	33,944,788 (GRCm39)	missense	possibly damaging	0.94
Z1177:Garre1	UTSW	7	33,984,180 (GRCm39)	missense	probably damaging	0.96
Z1186:Garre1	UTSW	7	33,945,185 (GRCm39)	missense	probably benign
Z1186:Garre1	UTSW	7	33,938,583 (GRCm39)	missense	probably benign	0.03
Z1186:Garre1	UTSW	7	33,938,533 (GRCm39)	missense	probably benign
Z1191:Garre1	UTSW	7	33,945,185 (GRCm39)	missense	probably benign
Z1191:Garre1	UTSW	7	33,938,583 (GRCm39)	missense	probably benign	0.03
Z1191:Garre1	UTSW	7	33,938,533 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTGATGGGCAGCAGGCTAG -3'
(R):5'- GGCTGGCACACAATGAAAACTC -3'

Sequencing Primer
(F):5'- CAGGCTAGCTGTAGTCAGTAC -3'
(R):5'- AAAATCTCTCTTCTGTTTCCCAGG -3'

Posted On

2018-08-01