Incidental Mutation 'R0763:Tmem30c'
ID72530
Institutional Source Beutler Lab
Gene Symbol Tmem30c
Ensembl Gene ENSMUSG00000022753
Gene Nametransmembrane protein 30C
Synonyms4933409A18Rik, 4933401B01Rik
MMRRC Submission 038943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0763 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57266139-57292865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57270176 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 223 (I223F)
Ref Sequence ENSEMBL: ENSMUSP00000113896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023434] [ENSMUST00000119407] [ENSMUST00000120112]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023434
AA Change: I223F

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023434
Gene: ENSMUSG00000022753
AA Change: I223F

DomainStartEndE-ValueType
Pfam:CDC50 54 339 2.7e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119407
AA Change: I223F

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112989
Gene: ENSMUSG00000022753
AA Change: I223F

DomainStartEndE-ValueType
Pfam:CDC50 53 340 2.6e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120112
AA Change: I223F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113896
Gene: ENSMUSG00000022753
AA Change: I223F

DomainStartEndE-ValueType
Pfam:CDC50 53 283 9.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231600
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,838,279 F290V probably damaging Het
Adam26b G A 8: 43,520,564 S467L probably damaging Het
Adgrv1 T A 13: 81,499,125 I3099F probably damaging Het
Akap6 A G 12: 53,142,214 D2137G possibly damaging Het
Arhgdig T C 17: 26,200,301 Y48C probably damaging Het
Astn1 A G 1: 158,509,890 I389V possibly damaging Het
Atp8a1 T C 5: 67,659,883 D920G probably benign Het
BC016579 T A 16: 45,629,455 N200I probably damaging Het
Casc3 T C 11: 98,831,318 Y661H probably damaging Het
Cep120 A C 18: 53,721,737 V442G probably benign Het
Cfap65 A G 1: 74,904,682 Y1557H probably damaging Het
Chd2 G T 7: 73,447,274 Q1485K possibly damaging Het
Cntrl T C 2: 35,171,066 F1967L probably benign Het
Csmd1 G A 8: 17,027,284 T119M possibly damaging Het
Dnah9 T C 11: 66,155,530 H64R probably benign Het
Ep400 T C 5: 110,665,837 R2899G probably damaging Het
Fam205a1 A G 4: 42,851,238 V306A probably damaging Het
Foxl2 A C 9: 98,956,033 T125P probably damaging Het
Foxred1 A T 9: 35,207,473 probably null Het
H2-Eb1 T A 17: 34,314,159 probably benign Het
Heatr3 T C 8: 88,158,241 S378P probably damaging Het
Hectd4 T C 5: 121,307,033 probably benign Het
Hps3 T G 3: 20,003,279 R780S probably damaging Het
Ifi44 G A 3: 151,749,498 A30V probably damaging Het
Il12rb1 G A 8: 70,813,290 probably benign Het
Invs G A 4: 48,392,628 G281R possibly damaging Het
Itgax C A 7: 128,147,940 probably benign Het
Jade1 G T 3: 41,613,783 C762F possibly damaging Het
Lama1 C T 17: 67,772,818 P1229S probably damaging Het
Mmp15 C A 8: 95,368,228 D243E probably benign Het
Mug2 A G 6: 122,075,294 T1004A probably benign Het
Myh14 A T 7: 44,665,367 V44E probably damaging Het
N4bp2l1 C A 5: 150,594,404 R11S possibly damaging Het
Notch4 T A 17: 34,565,332 C36* probably null Het
Nwd1 A G 8: 72,671,044 D637G probably damaging Het
Ogfod1 T C 8: 94,055,636 I238T probably benign Het
Palm2 G A 4: 57,688,441 E95K probably damaging Het
Papln A G 12: 83,791,865 D1256G possibly damaging Het
Ppp1r26 T C 2: 28,450,367 L3P probably damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc17a5 A T 9: 78,553,090 probably benign Het
Slc25a17 A G 15: 81,323,706 probably benign Het
Socs4 T C 14: 47,290,655 F349S probably damaging Het
Tchhl1 A C 3: 93,471,571 E527D probably benign Het
Tm7sf3 A G 6: 146,606,289 L425S possibly damaging Het
Tmem266 G T 9: 55,414,955 V112L probably damaging Het
Tomm70a G A 16: 57,122,172 G104D probably benign Het
Ttc17 G T 2: 94,332,803 A834E probably benign Het
Ttn C T 2: 76,731,190 V20664M probably damaging Het
Zbed5 T C 5: 129,902,179 V323A probably benign Het
Other mutations in Tmem30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tmem30c APN 16 57270074 missense probably damaging 1.00
IGL01115:Tmem30c APN 16 57276117 splice site probably benign
IGL01574:Tmem30c APN 16 57276742 missense possibly damaging 0.60
IGL02060:Tmem30c APN 16 57290898 missense probably benign
IGL03243:Tmem30c APN 16 57276150 missense probably benign 0.00
R0689:Tmem30c UTSW 16 57270173 missense probably damaging 1.00
R0699:Tmem30c UTSW 16 57276789 missense possibly damaging 0.69
R1353:Tmem30c UTSW 16 57277665 missense probably damaging 1.00
R1518:Tmem30c UTSW 16 57266492 missense probably damaging 0.99
R1707:Tmem30c UTSW 16 57266480 missense possibly damaging 0.79
R1843:Tmem30c UTSW 16 57276780 missense probably benign 0.02
R1865:Tmem30c UTSW 16 57269989 splice site probably benign
R2021:Tmem30c UTSW 16 57281362 missense probably damaging 1.00
R3419:Tmem30c UTSW 16 57277668 missense probably benign 0.25
R5007:Tmem30c UTSW 16 57266505 missense probably benign 0.00
R5204:Tmem30c UTSW 16 57270022 missense possibly damaging 0.89
R5626:Tmem30c UTSW 16 57276143 missense possibly damaging 0.74
R5863:Tmem30c UTSW 16 57270055 missense probably benign 0.02
R5869:Tmem30c UTSW 16 57266562 missense probably damaging 0.99
R6133:Tmem30c UTSW 16 57277737 missense probably damaging 1.00
R6359:Tmem30c UTSW 16 57276150 missense probably benign 0.00
R6813:Tmem30c UTSW 16 57281259 critical splice donor site probably null
R7268:Tmem30c UTSW 16 57266414 missense probably damaging 0.98
R7387:Tmem30c UTSW 16 57270023 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTACCAGCAGGTAAGCCTTCAGCG -3'
(R):5'- TCTACTAGGGCCTGTGATTCCAGTG -3'

Sequencing Primer
(F):5'- CCTTCAGCGAAGGCGTG -3'
(R):5'- ttccttccttcctccctcc -3'
Posted On2013-09-30